ID: 905804159

View in Genome Browser
Species Human (GRCh38)
Location 1:40863817-40863839
Sequence AGAGAGTGTCAAATGCGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 96}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905804159_905804166 17 Left 905804159 1:40863817-40863839 CCTCCACGCATTTGACACTCTCT 0: 1
1: 0
2: 0
3: 3
4: 96
Right 905804166 1:40863857-40863879 CCCCCGACCTGTGGCATCCTTGG 0: 1
1: 0
2: 1
3: 5
4: 114
905804159_905804172 27 Left 905804159 1:40863817-40863839 CCTCCACGCATTTGACACTCTCT 0: 1
1: 0
2: 0
3: 3
4: 96
Right 905804172 1:40863867-40863889 GTGGCATCCTTGGGACTTCCTGG 0: 1
1: 0
2: 0
3: 14
4: 167
905804159_905804163 8 Left 905804159 1:40863817-40863839 CCTCCACGCATTTGACACTCTCT 0: 1
1: 0
2: 0
3: 3
4: 96
Right 905804163 1:40863848-40863870 TCTGACCTTCCCCCGACCTGTGG 0: 1
1: 0
2: 2
3: 11
4: 126
905804159_905804168 18 Left 905804159 1:40863817-40863839 CCTCCACGCATTTGACACTCTCT 0: 1
1: 0
2: 0
3: 3
4: 96
Right 905804168 1:40863858-40863880 CCCCGACCTGTGGCATCCTTGGG 0: 1
1: 0
2: 2
3: 8
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905804159 Original CRISPR AGAGAGTGTCAAATGCGTGG AGG (reversed) Intergenic
903467621 1:23563182-23563204 ACAGAGAGTCAAATGAGAGGAGG - Intergenic
903469430 1:23575567-23575589 AGAGGGTGTCACAAGAGTGGAGG - Intergenic
905804159 1:40863817-40863839 AGAGAGTGTCAAATGCGTGGAGG - Intergenic
906674825 1:47685836-47685858 AGAGATTTTGAAATGCCTGGTGG + Intergenic
908773264 1:67615392-67615414 ACAGAGTGACTAATGCCTGGAGG + Intergenic
910253583 1:85223458-85223480 AGAGAGAGTCACGTGCATGGGGG + Intergenic
915952057 1:160195995-160196017 GGAGATTGTCAACTTCGTGGAGG + Exonic
917265716 1:173218513-173218535 AGAGAGTGTGAAAGGAGAGGGGG - Intergenic
918163732 1:181924863-181924885 GGAGAGTGGCAAAAGTGTGGAGG - Intergenic
921359514 1:214317683-214317705 AGAAAGTGTAAAATGGATGGGGG + Intronic
1071050191 10:81438577-81438599 AGAGTGTGTCAAATGGAAGGGGG - Intergenic
1073191152 10:101651326-101651348 AGAGGGTGGGAAATGGGTGGGGG + Intronic
1073618560 10:105023413-105023435 AGAGAGTTTCCAATGGTTGGAGG + Intronic
1075977283 10:126706698-126706720 AGACATTGTCAAATGGGGGGTGG - Intergenic
1083491683 11:63018723-63018745 AAAGAGTGTCCACTGTGTGGAGG - Intergenic
1084313064 11:68327701-68327723 AGAAAGTGTGACAGGCGTGGAGG + Intronic
1090050805 11:123377393-123377415 AAAGAGAGCAAAATGCGTGGTGG + Intergenic
1090745694 11:129703145-129703167 TGAGATTGCCAAATGCATGGAGG - Intergenic
1091677018 12:2498944-2498966 AGGGAGTTTGAAATGCATGGAGG + Intronic
1091773403 12:3168505-3168527 AGAGAGTGTCACAAGCTGGGAGG + Intronic
1092905069 12:13093584-13093606 ATAGAGTTTCAAATGCGAGGTGG + Intronic
1097024136 12:56041755-56041777 AGAGAGGGACAGATGCTTGGTGG - Intergenic
1114652074 14:24291568-24291590 ATTGAGTGGCAAATGTGTGGTGG - Exonic
1114771455 14:25431750-25431772 ACAGTGGGTCAAATGCATGGGGG - Intergenic
1120952187 14:90051459-90051481 AGAGAGGGTCACCTGTGTGGTGG + Intergenic
1121532160 14:94662577-94662599 TGAGAGAGTCATATGGGTGGAGG - Intergenic
1121658514 14:95616562-95616584 AGAGAATGTCTAATGTGTGATGG - Intergenic
1122046069 14:99024936-99024958 AGAGAATGTGCAATGCATGGAGG + Intergenic
1122175969 14:99919465-99919487 AAAGAGAGTCAAATGGGAGGTGG - Intronic
1127725271 15:61743634-61743656 AGAGAGTGCTAAATGAATGGTGG + Intergenic
1128383278 15:67128938-67128960 ACAGAGTGTTGAGTGCGTGGTGG + Intronic
1130936888 15:88478320-88478342 AGAGAGTGTGAAATGAGGTGAGG + Exonic
1132097074 15:98994671-98994693 AGACAGTGTGAAATGCAAGGAGG - Intronic
1133851295 16:9506335-9506357 AGAGACTGTAAAATGCATCGTGG - Intergenic
1141433328 16:83982217-83982239 AGAGACTGTCTAATACATGGCGG - Intronic
1146364190 17:32206149-32206171 AGTGAGTGACTAATGTGTGGGGG - Intronic
1148085770 17:44993051-44993073 TGAGAGTGTCCATTGCTTGGAGG - Intergenic
1148198689 17:45733409-45733431 AGAGAGTCCCAAGGGCGTGGGGG - Intergenic
1148201805 17:45754151-45754173 AGAAAGGGTCAAATGGGTGTGGG - Intergenic
1149571769 17:57677263-57677285 AGAGAGAGTCAAAAAGGTGGGGG - Intronic
1156467364 18:37356343-37356365 GGAGAGTGACAAAAGGGTGGGGG + Intronic
1164398923 19:27889504-27889526 AGAGAGAGACAAATGGGTTGGGG + Intergenic
926123218 2:10256011-10256033 AGAGAGTGCCAAATTGGGGGTGG + Intergenic
929044922 2:37779985-37780007 AGAGAGTGGCAAATGCAAGCCGG - Intergenic
929553630 2:42910005-42910027 AGAGAGGGTTAAATGCGTATTGG + Intergenic
930542731 2:52727785-52727807 AGATAGGGTCAAATACATGGAGG - Intergenic
932239283 2:70144295-70144317 ACAGAGTTTCAAAAACGTGGGGG - Intergenic
937812863 2:126217999-126218021 AGATAGTGCCAAATGCATGAAGG - Intergenic
944125908 2:196292521-196292543 AGGGAGTGCCAAATGCCTGTGGG - Intronic
945352418 2:208796988-208797010 AGAAAGTATCAAATGAGTCGTGG - Intronic
946237456 2:218332823-218332845 AGAGAGTGGAAAATGGCTGGTGG - Intronic
948238186 2:236406309-236406331 AGAGCGATTCAAATGCATGGAGG + Intronic
1171562279 20:26136431-26136453 AGAGGGTGTCAAGTGGGAGGAGG + Intergenic
1174479315 20:50819749-50819771 AGAAAGAGTCCAATGCGTGGTGG - Intronic
1177581145 21:23022728-23022750 AGACAATGTGAAATGCCTGGAGG - Intergenic
1177812050 21:25935102-25935124 ACTGTGTGTCAAATGCCTGGCGG + Intronic
1180880024 22:19197106-19197128 GGAGAGTGTCAGAGGCGTGTGGG - Intronic
1184562273 22:45269931-45269953 AGAGACTGTGAAAAGCGGGGAGG - Intergenic
949168255 3:966758-966780 AGAGATTGTCAAATGAGGTGAGG + Intergenic
951302158 3:21011035-21011057 AGAGAGTGTTAAATCTGTTGTGG - Intergenic
953270580 3:41439064-41439086 AGAGAGTGTGAAATGGGGGTTGG + Intronic
956387232 3:68732912-68732934 AGAGGATGTCAAATGGGTGGTGG + Exonic
957889593 3:86339321-86339343 AGAGAGTGTGAAGTGTGTGTTGG + Intergenic
964709969 3:159661556-159661578 AAAGAGTGTCTAATTCATGGTGG + Intronic
966674720 3:182572554-182572576 GGAGAGTGTCAGCTGCTTGGAGG - Intergenic
968843948 4:3029310-3029332 AGAGAAAGTCAAATGGGAGGAGG + Exonic
970334972 4:15027644-15027666 AGAGTCTGTCAAATGAGTTGGGG + Intronic
974053274 4:56961000-56961022 GGAGAGTGTGAAATACATGGGGG + Intergenic
974310861 4:60208768-60208790 AGAGAGAGTCAGAAGGGTGGGGG + Intergenic
978846141 4:113275106-113275128 TGAGAATGTCAAATAAGTGGTGG - Intronic
983705403 4:170652511-170652533 AGAGAGTGTAATTTGCATGGGGG + Intergenic
984288340 4:177761996-177762018 TGAGGCTGTCAAATGTGTGGTGG - Intronic
990377848 5:55190607-55190629 AGAGAGTAACAAATACGAGGAGG + Intergenic
993043340 5:82839932-82839954 AGAGAGAATCAAAAGCATGGAGG - Intergenic
993697305 5:91077003-91077025 AGAGAGTGTCAAGTGCTCCGTGG - Intronic
997963516 5:138339372-138339394 TGAGAGTATCAGTTGCGTGGTGG + Intronic
1000266593 5:159643777-159643799 AAAGGGTGTCTAATGCCTGGGGG + Intergenic
1004159001 6:13196928-13196950 AGAGAGTGTTTAATATGTGGTGG - Intronic
1004249870 6:14015039-14015061 AGATAGTGGCAAATAGGTGGAGG - Intergenic
1005385326 6:25279592-25279614 AAAGAGTTGCAAATGCGAGGCGG - Exonic
1014163836 6:118201163-118201185 AGAGGGGGTGAAATGCATGGAGG + Intronic
1016627635 6:146191019-146191041 AGAGAATGGCAAGTGCATGGAGG - Intronic
1018645546 6:165944430-165944452 AGTGAGTGTCCCATGCCTGGGGG - Intronic
1018986820 6:168643942-168643964 AGGGAGTGTCACATGTGTGACGG - Intronic
1019066301 6:169302206-169302228 AGAGAGAGTCAAATGAATGTGGG + Intergenic
1019703211 7:2484484-2484506 AGAGAGTGCCTACTGGGTGGCGG + Intergenic
1023976756 7:45036177-45036199 ACAGAGTGACAGAGGCGTGGTGG + Intronic
1024334179 7:48188495-48188517 AGAGATTGTCAACTGAGTTGGGG + Intronic
1027746854 7:82086049-82086071 AGAGATTGTCAAATGCAAAGTGG - Intronic
1028058368 7:86277490-86277512 ACAGATTTTCAAATGCATGGGGG + Intergenic
1028767690 7:94578553-94578575 TGAGACTGGCAAATGGGTGGGGG - Intergenic
1041938541 8:63361166-63361188 AGAGGCAGTCAAATGCATGGCGG + Intergenic
1047521598 8:125599238-125599260 AGAGAGGGGCACATGCATGGTGG + Intergenic
1051564354 9:18480355-18480377 AGAGAGTGTTTGATGCTTGGAGG - Intronic
1055449713 9:76419820-76419842 AGAGAGTAGCAACTGTGTGGTGG - Intergenic
1057150313 9:92790852-92790874 AAAAAGTGTAAAATGCTTGGTGG + Intergenic
1062223023 9:135429780-135429802 AGAGAATGTAAAATTCATGGAGG + Intergenic
1185689380 X:2140643-2140665 AGAGAGTGGTGAAGGCGTGGAGG + Intergenic
1185982798 X:4798415-4798437 AGATACTGTCAAATGCCTAGGGG - Intergenic
1188138059 X:26514350-26514372 AGAGAGTGTCATAAGCAAGGTGG + Intergenic