ID: 905804161

View in Genome Browser
Species Human (GRCh38)
Location 1:40863842-40863864
Sequence GTCGGGGGAAGGTCAGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 338
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 314}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905804161_905804175 10 Left 905804161 1:40863842-40863864 CCCTTCTCTGACCTTCCCCCGAC 0: 1
1: 0
2: 1
3: 22
4: 314
Right 905804175 1:40863875-40863897 CTTGGGACTTCCTGGAACTTGGG 0: 1
1: 0
2: 0
3: 16
4: 230
905804161_905804168 -7 Left 905804161 1:40863842-40863864 CCCTTCTCTGACCTTCCCCCGAC 0: 1
1: 0
2: 1
3: 22
4: 314
Right 905804168 1:40863858-40863880 CCCCGACCTGTGGCATCCTTGGG 0: 1
1: 0
2: 2
3: 8
4: 86
905804161_905804172 2 Left 905804161 1:40863842-40863864 CCCTTCTCTGACCTTCCCCCGAC 0: 1
1: 0
2: 1
3: 22
4: 314
Right 905804172 1:40863867-40863889 GTGGCATCCTTGGGACTTCCTGG 0: 1
1: 0
2: 0
3: 14
4: 167
905804161_905804166 -8 Left 905804161 1:40863842-40863864 CCCTTCTCTGACCTTCCCCCGAC 0: 1
1: 0
2: 1
3: 22
4: 314
Right 905804166 1:40863857-40863879 CCCCCGACCTGTGGCATCCTTGG 0: 1
1: 0
2: 1
3: 5
4: 114
905804161_905804174 9 Left 905804161 1:40863842-40863864 CCCTTCTCTGACCTTCCCCCGAC 0: 1
1: 0
2: 1
3: 22
4: 314
Right 905804174 1:40863874-40863896 CCTTGGGACTTCCTGGAACTTGG 0: 1
1: 0
2: 0
3: 11
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905804161 Original CRISPR GTCGGGGGAAGGTCAGAGAA GGG (reversed) Intergenic
901742792 1:11353217-11353239 TACGGGGGCAGGACAGAGAAGGG - Intergenic
903386630 1:22931080-22931102 GTCTGGGGAGGGTCAGCCAATGG + Intergenic
903706401 1:25288955-25288977 TTTAGGGGAAGGTCAGAAAAGGG - Intronic
904625300 1:31798936-31798958 GCCGGGGTCAGGTCAGAGTAAGG + Intronic
905238305 1:36565610-36565632 GGAGGGGGAAGGTGAGGGAAAGG - Intergenic
905492918 1:38359304-38359326 CTATGGTGAAGGTCAGAGAAGGG - Intergenic
905755908 1:40508909-40508931 GTTAGGGGAAGGCCGGAGAATGG + Exonic
905760197 1:40550055-40550077 GGCCGGGGAAGGAGAGAGAATGG - Intergenic
905804161 1:40863842-40863864 GTCGGGGGAAGGTCAGAGAAGGG - Intergenic
905878763 1:41449983-41450005 TGCCAGGGAAGGTCAGAGAAAGG + Intergenic
906247101 1:44284006-44284028 GTCAGAGGAAGCTCAGAGAAAGG - Intronic
907512569 1:54972753-54972775 GTGGGTGGAGGGTCAGATAAAGG + Intergenic
907537040 1:55172125-55172147 ATCGGGGAGAGGTAAGAGAAAGG + Intronic
909029548 1:70523576-70523598 GTCTGGTGAAGGTCAGAAATAGG - Intergenic
909839534 1:80301789-80301811 ATCCGGGGAAGGGTAGAGAAAGG - Intergenic
910676561 1:89821611-89821633 GGCGGAGGGAGGTGAGAGAAGGG - Intronic
913333686 1:117687721-117687743 GCTGTGGGAAGGTCAGAGCAGGG + Intergenic
913546232 1:119871630-119871652 GTCGGGGGCATTCCAGAGAAAGG - Intergenic
914912528 1:151799390-151799412 GTCGGAGGAGGGACTGAGAAGGG - Intergenic
915508476 1:156372326-156372348 GTAGGGGGAAGGCCACAGATGGG - Intronic
915536093 1:156536463-156536485 GTCTGGGGAGGGTAGGAGAAGGG + Intronic
915541857 1:156572466-156572488 GTGCGGAGAGGGTCAGAGAAGGG - Intronic
915562931 1:156697946-156697968 GTAGGGGGTGGGTCAGAGACAGG + Intergenic
915727035 1:158025333-158025355 CTCGGGGAAACGACAGAGAAAGG + Intronic
915978878 1:160408060-160408082 GTCTGGGGAAGGCTAGGGAATGG + Intronic
916602434 1:166306183-166306205 ATCAGGGGAAGGTTAGGGAAGGG + Intergenic
921449572 1:215289192-215289214 GTCAGTGGAGGGTCAGAGATGGG - Intergenic
922035147 1:221840452-221840474 GTCTGGGGAAAGAAAGAGAAAGG + Intergenic
922337889 1:224632551-224632573 GTAGGGGGCAGGTCTGGGAAGGG + Intronic
924037128 1:239949192-239949214 GTTGGGGGAGGGACTGAGAATGG - Intergenic
924815719 1:247440281-247440303 GGCAGGAGCAGGTCAGAGAACGG - Intronic
1063085112 10:2809914-2809936 GTGGGGGGAAGACTAGAGAAAGG - Intergenic
1063242916 10:4189901-4189923 GAAGGTGGAAGGTGAGAGAAGGG - Intergenic
1063681047 10:8188332-8188354 CCTGGGGGAAGGTCAGAGGATGG + Intergenic
1063877353 10:10493935-10493957 GTCAGGGGAAGGTTAGAGGCAGG - Intergenic
1064221464 10:13444427-13444449 TTTGGGGGAAGGGCAGGGAAAGG - Intronic
1064349905 10:14567310-14567332 GCAGTGGGAAGGTCAGAGAATGG + Intronic
1065083256 10:22147917-22147939 GTCGGGGGAAGATGATAGGAGGG - Intergenic
1066654355 10:37684814-37684836 GTTGATGAAAGGTCAGAGAAAGG - Intergenic
1069961834 10:72083726-72083748 GTGGAGGGGAGGTCAGGGAAAGG + Intronic
1070500072 10:77064358-77064380 GTTGGGGGAAGGAGGGAGAAGGG + Intronic
1070535933 10:77377235-77377257 GTGGGCTGAAGGTCAGTGAAAGG - Intronic
1072321119 10:94251147-94251169 ATCGGGGTATGGTTAGAGAAGGG + Intronic
1072521710 10:96235627-96235649 AGCGGGGAAAGTTCAGAGAAAGG + Intronic
1072973682 10:100039114-100039136 GTCTTGGGAAGGTCAGGAAAGGG - Intergenic
1073348442 10:102801954-102801976 GTGGGGGGAAGGGTAGGGAAGGG - Intronic
1074992124 10:118718322-118718344 GTGGGGGGCAGGACAGGGAAGGG + Intronic
1075314014 10:121437764-121437786 GTGGGAGGTAGGCCAGAGAAGGG + Intergenic
1075453146 10:122567412-122567434 GACTGGGGAAGGACAGAGCATGG + Intronic
1078462603 11:11526027-11526049 GTGGGGGAAAGGTATGAGAAAGG + Intronic
1078664260 11:13311371-13311393 GTCCCGGGAAGGGAAGAGAATGG + Intronic
1078679432 11:13462504-13462526 GGCGGGGGAAGGTGAGACATCGG - Intronic
1081341025 11:41927659-41927681 GTCGAGGGGAGGTTAGAGTATGG + Intergenic
1081537124 11:44004282-44004304 GTCTGGGGAAGGACACAGAGCGG + Intergenic
1083681815 11:64354899-64354921 GCAGGGAGGAGGTCAGAGAAGGG - Intronic
1083681880 11:64355114-64355136 GTAGGGAGGAGGTCAGAGAATGG - Intronic
1084109310 11:67003106-67003128 CTCAGGGGAAGGACAGAGAAAGG + Intergenic
1084145415 11:67262622-67262644 CTCGGGAGAAGGTCAGGGGAGGG - Intergenic
1084416368 11:69035253-69035275 GTCGGGGGAGGGTCTGAGCTCGG + Intergenic
1086936430 11:92750331-92750353 GTCGGGGGATGGTCAGGATAGGG + Intronic
1087156622 11:94910776-94910798 GTTGCGGGAAGGGAAGAGAATGG - Intergenic
1087685478 11:101258256-101258278 GACAGGGGAAGGAAAGAGAAAGG - Intergenic
1089625576 11:119748814-119748836 GTGGTGAGAAGGACAGAGAAGGG + Intergenic
1090470829 11:126979503-126979525 GTCTGGGGAAGGTGAGAGTCTGG + Intronic
1091491592 12:937271-937293 GTAGGGGAAAGGTGAGTGAAGGG - Intronic
1095463678 12:42468051-42468073 GTCAGGGGAAGCTGGGAGAAGGG + Intronic
1095938694 12:47711778-47711800 GTGGAGGGAAGGGCAGAAAAGGG + Intronic
1096412538 12:51387770-51387792 TTGGGGGAAAGGACAGAGAAGGG + Intronic
1097726456 12:63080575-63080597 GTCTGAGGAAGGTTAGTGAAGGG - Intergenic
1100436087 12:94572802-94572824 GGCGGAGGAAGGCGAGAGAAGGG + Intronic
1101437537 12:104677013-104677035 GTCGGGAGAAGGTTGGAGAAGGG - Intronic
1101835973 12:108295701-108295723 GGGAGGGGAAGGTCAGAGATGGG - Intronic
1102454484 12:113063264-113063286 GTCGGGGAAAGGTTTGAGAATGG + Intronic
1102671893 12:114626748-114626770 GAGGGGGGAGGGTCAGAGGAGGG + Intergenic
1103515255 12:121503664-121503686 GAAGGGGGAAGGAAAGAGAAAGG + Intronic
1103982246 12:124744146-124744168 GTCAGGGGCCGGCCAGAGAATGG + Intergenic
1104418332 12:128614194-128614216 GGCTAGAGAAGGTCAGAGAAGGG - Intronic
1108211144 13:48141123-48141145 TTTGAGGGAAGGTCAAAGAAGGG + Intergenic
1108733960 13:53263011-53263033 TTTGGGGGAGGGTCACAGAAAGG - Intergenic
1109571482 13:64196882-64196904 GTCTGTGGAGGGTTAGAGAAAGG + Intergenic
1111274455 13:85930109-85930131 GTTGTGGGAAGGACAAAGAAAGG + Intergenic
1111466662 13:88622353-88622375 CTCGGGAGAAGGACAGAGAAGGG + Intergenic
1111991523 13:95121818-95121840 GAGAGGGGAAGGGCAGAGAAGGG - Intronic
1112504988 13:99970185-99970207 GCCGGGGAAAGGGCAGGGAAAGG + Exonic
1113221169 13:108104111-108104133 GGCGGGGGAAGGTGGGGGAAGGG + Intergenic
1113704435 13:112417674-112417696 GTCCTGGGTAGATCAGAGAAAGG - Intronic
1114533542 14:23409701-23409723 GTGGGGGGAAGGCCAGAGCAGGG - Intergenic
1115279532 14:31646174-31646196 AGCGGGGGAAGGGCAGGGAAGGG - Intronic
1117244383 14:53869608-53869630 GAGGGGGGAAGGTGAGAGGAGGG + Intergenic
1118114709 14:62762146-62762168 GGCTTGGGAAAGTCAGAGAATGG + Intronic
1118730256 14:68661005-68661027 TTCAGGGGAAAGTCAGTGAATGG + Intronic
1119732155 14:76957761-76957783 GTCTGGGGAAGGGCAGGGCAGGG - Intergenic
1120112612 14:80575505-80575527 CAGGGGGGAAGGTAAGAGAAAGG + Intronic
1120586843 14:86322294-86322316 GTGGTGGGAAGGGCAGGGAAGGG - Intergenic
1121666633 14:95677312-95677334 GTCTGGGGAAGGAGAAAGAATGG + Intergenic
1123488767 15:20763811-20763833 GCCTAGGGAAGGTCAGGGAATGG - Intergenic
1123545266 15:21332898-21332920 GCCTAGGGAAGGTCAGGGAATGG - Intergenic
1124666057 15:31593826-31593848 ATCGGGGGAATGGCAGAGAGTGG - Intronic
1125097402 15:35870696-35870718 GTCGGGAGAACCCCAGAGAATGG + Intergenic
1128314772 15:66653645-66653667 GTCGAGGGCAGGTCAGTGGAGGG + Intronic
1128560824 15:68666693-68666715 GTTGGGGGATGGGCAGGGAAGGG + Intronic
1128743732 15:70099577-70099599 GTAAGGGGGAGGGCAGAGAAGGG - Intergenic
1129151826 15:73693901-73693923 GTGGGGGGAGGGGCAGGGAAAGG + Intronic
1129272216 15:74424952-74424974 GTCGGGGAGAGGGCGGAGAATGG + Intronic
1130159644 15:81385722-81385744 GTCGGGGGCCTGTGAGAGAAGGG + Intergenic
1130655276 15:85788273-85788295 GCCGTGGGAGGATCAGAGAAAGG - Intronic
1131105286 15:89729650-89729672 GGCGGGGGAAAGACAGAAAATGG - Intronic
1131317618 15:91353838-91353860 GCATGGGGAGGGTCAGAGAAAGG - Intergenic
1132265287 15:100464994-100465016 GGCTGGGGAAAATCAGAGAAAGG + Intronic
1202953612 15_KI270727v1_random:60169-60191 GCCTAGGGAAGGTCAGGGAATGG - Intergenic
1132691238 16:1182806-1182828 GTCTGGGCAACGTCAGAGGAGGG - Intronic
1134354964 16:13473536-13473558 CTCTGGGAAAGGTCAGAAAAAGG - Intergenic
1134391893 16:13827712-13827734 GTCGGAGGAGGGTGAGAGGAGGG - Intergenic
1137359677 16:47802370-47802392 GCTGGGGGAAGGTAAGAGGAGGG + Intergenic
1137368688 16:47884306-47884328 GAGGTGGGAAGGTGAGAGAAAGG + Intergenic
1137487768 16:48906134-48906156 GCCGGGGGGAGGTCACAGCAGGG - Intergenic
1137533398 16:49298804-49298826 GACTGGGGTAGGGCAGAGAAGGG - Intergenic
1137673512 16:50292559-50292581 GTGGGTTGAAGGTCAGGGAATGG + Intronic
1137864711 16:51881322-51881344 AACTGGGGAAGGGCAGAGAAAGG - Intergenic
1138344141 16:56309510-56309532 GTGGGGACAAGGACAGAGAAGGG + Intronic
1138479124 16:57290175-57290197 GTGGGGATAAGGTCAGAGCAGGG - Intergenic
1139551160 16:67673862-67673884 GAGGGCGGAAGGTTAGAGAAGGG + Intergenic
1142694547 17:1626594-1626616 CTCCGGGGCAGATCAGAGAAGGG + Intronic
1143118607 17:4594041-4594063 ATGGGGGGAAGGTCTGAGCAGGG + Intronic
1143410364 17:6704839-6704861 GTAGGGGGAAGGATTGAGAAGGG - Intronic
1145241940 17:21245237-21245259 GTGAGGGGAAGGGCAGAGATGGG + Intronic
1145265602 17:21378255-21378277 GGCGGGCGAGGGTCAGAGAGGGG + Intronic
1146178120 17:30679623-30679645 GACGGGGGGAGGACAGAGGAGGG + Intergenic
1146659453 17:34654664-34654686 GTCGGGGCAGAGTGAGAGAATGG - Intergenic
1147246232 17:39122921-39122943 ATTGGGAGAAGGACAGAGAAGGG + Intronic
1147335947 17:39727070-39727092 GTTGAGGGAACATCAGAGAAAGG - Intronic
1147547465 17:41413660-41413682 GTTGGAGGAAGGTCATCGAAGGG - Intergenic
1148206672 17:45784093-45784115 GCCGGGGGAAGGGGAGGGAACGG + Intergenic
1149126793 17:53244327-53244349 GTAGTGGAAAAGTCAGAGAATGG + Intergenic
1149645651 17:58239637-58239659 ATAGGGGGAAGGCCTGAGAAGGG - Intronic
1150672328 17:67211882-67211904 GAAGGGGGAAGGTAAGGGAAGGG + Intronic
1151260583 17:72912856-72912878 ATGGGGAGAAGGTCAAAGAAGGG - Intronic
1152013213 17:77733639-77733661 AGCTGGGGAAGCTCAGAGAAAGG - Intergenic
1152053496 17:78001565-78001587 GTAGGGGGAGGGAGAGAGAAGGG + Intergenic
1152911198 17:83005830-83005852 GGCGGGGGAAGGGTTGAGAAAGG - Intronic
1153785923 18:8535363-8535385 GATGGGGGAGGGTGAGAGAAAGG + Intergenic
1155860948 18:30898714-30898736 GTCGTGGGATGGGCAGAGAGGGG + Intergenic
1157333729 18:46722007-46722029 GTCGGGAGAAGGCCATAGAAGGG + Intronic
1157590562 18:48834009-48834031 GGAGGGGGAAGGGGAGAGAAGGG - Intronic
1158587616 18:58755309-58755331 GTTGGGGGAAGGTCAGATAGGGG + Intergenic
1158588901 18:58763231-58763253 TGCGGGGGAAGGAGAGAGAAAGG + Intergenic
1159731787 18:72035879-72035901 GTTGGGGGAAGGACAGTGATAGG - Intergenic
1160763453 19:797183-797205 GTCGGGGGAGGGGGAGAAAATGG - Exonic
1161200831 19:3013873-3013895 GTCGGGAGGAGGATAGAGAAGGG - Intronic
1161956599 19:7499381-7499403 GGCGGGGGAGGGGGAGAGAAGGG + Intronic
1162110581 19:8397693-8397715 GCCAGGGGAAGGGCAGAGGAGGG + Intronic
1162924516 19:13923503-13923525 GTCGAGGGAAGGGAAGAGAGGGG - Intronic
1163188283 19:15656063-15656085 GGTGGGGGAGGGACAGAGAAGGG - Intronic
1164267556 19:23633669-23633691 ATCAGGGAGAGGTCAGAGAAAGG + Intronic
1164525855 19:29013132-29013154 CTGCGGGGAAGCTCAGAGAATGG - Intergenic
1164870093 19:31635897-31635919 TTCAGAGGAAGGGCAGAGAAAGG - Intergenic
1165782531 19:38442578-38442600 GTGGGGGGCAGGGCAGAGAGAGG - Intronic
1166827934 19:45621073-45621095 GTCAGGGCCAGGTCAGAGAAGGG + Intronic
1167453867 19:49588320-49588342 GGCAGTGGAGGGTCAGAGAAAGG + Intronic
1167568437 19:50271715-50271737 GGGGGAGGAAGGTCAGAGAAGGG + Intronic
925189821 2:1874032-1874054 GTCGGGGGAAGGACAGGGAGAGG + Intronic
926972051 2:18475947-18475969 GGCGGGGGAAGGGAAGGGAAGGG + Intergenic
927096965 2:19754676-19754698 ATCTGGGGAAGGGCACAGAATGG - Intergenic
927222121 2:20722266-20722288 GGCGGGGGAAGGTGGGAGAGAGG + Intronic
931052256 2:58428278-58428300 GAGGGGGGAAGGGGAGAGAAGGG + Intergenic
931927577 2:67090613-67090635 GTTGAGAGAAGGTGAGAGAAGGG + Intergenic
935534788 2:104281635-104281657 GTGGGGGGATGGTAAGAGGAGGG - Intergenic
937855761 2:126671155-126671177 GGCAGTGGAAGGTCAGGGAACGG - Intronic
939745691 2:145964090-145964112 GAGGGGGGAAGTTTAGAGAAAGG - Intergenic
940559709 2:155280497-155280519 TTTGGGGGAATGTAAGAGAAGGG - Intergenic
943318187 2:186414238-186414260 GTCAGGGGTAGGTCAGGGAGGGG + Intergenic
945844558 2:214928857-214928879 GTCAGGTGAAGGTAAGAGGATGG + Intergenic
947291215 2:228576756-228576778 GTGGGGGGAAGGAAAAAGAAAGG - Intergenic
948456942 2:238108992-238109014 GACGGGGGATGGTGAGAGGAAGG - Intronic
948789949 2:240372072-240372094 GGTGGGTGAAGGGCAGAGAAGGG - Intergenic
1168856411 20:1012452-1012474 CTAGGGGCAAGGCCAGAGAAGGG + Intergenic
1170842394 20:19934531-19934553 GTTGGGGAAAGGGAAGAGAAAGG - Intronic
1171051309 20:21861879-21861901 CTCGGGGGAAAGTATGAGAAGGG + Intergenic
1171983520 20:31643660-31643682 GTAGGGTGAAGGACAGAGCATGG + Intronic
1172055308 20:32150586-32150608 GAGGGAGGAAGGGCAGAGAAAGG - Intronic
1174548764 20:51345844-51345866 CTAGGGGGAAGTTCAGATAAAGG + Intergenic
1174875440 20:54222456-54222478 GGAGGGGGAGGGTGAGAGAAGGG + Intronic
1177330510 21:19654453-19654475 GTAGGGGGAAGGTCAGTGCTTGG + Intergenic
1178175805 21:30097017-30097039 GGTGGGAGAAGGTCAGAGAAAGG - Intergenic
1178639569 21:34335195-34335217 GTTAGGAGAAGGACAGAGAAAGG + Intergenic
1178787390 21:35666403-35666425 GGAGGAGGAAGGTCATAGAATGG - Intronic
1179377023 21:40859013-40859035 GACTGGGGTAGGACAGAGAAGGG + Intergenic
1179402994 21:41101836-41101858 GTAGGGGGAGAGTCAGAGAAAGG + Intergenic
1179575654 21:42306813-42306835 ACCGGGGAAAGGGCAGAGAAGGG - Intergenic
1180159753 21:45993704-45993726 GTCGGGGGGACGTCAAAGCAGGG + Intronic
1181689515 22:24550758-24550780 GGCTGGGGAAGGTCAGACATAGG - Intronic
1181853913 22:25769008-25769030 GTTGGGGGACGATCTGAGAATGG + Exonic
1182419584 22:30242389-30242411 TACGGGTGAAGCTCAGAGAAGGG - Exonic
1182426267 22:30274565-30274587 GACTGAGGAAGGCCAGAGAAAGG - Intergenic
1182765507 22:32755093-32755115 GTCTGGGGAAGGTTGGAGGAAGG + Intronic
1184129489 22:42509273-42509295 GAAGGAGGAAGGTCAGAGGAGGG + Intergenic
1184139690 22:42571366-42571388 GAAGGAGGAAGGTCAGAGGAGGG + Intronic
1184662368 22:45971244-45971266 GGAGGGGGAAGGGAAGAGAAGGG + Intronic
1185140101 22:49095369-49095391 GTCGGTGGGAGGCCACAGAAAGG + Intergenic
949840099 3:8311112-8311134 GTGGGGGGAAGGTGGGAGATGGG - Intergenic
949904703 3:8849347-8849369 GTGGCGGGACGGTCAGTGAAAGG + Intronic
950311332 3:11960959-11960981 GTGGGGGGAAGGACAGAGAACGG + Intergenic
952925620 3:38317228-38317250 GTAGGGAGGAGGGCAGAGAAAGG - Intronic
954332682 3:49899262-49899284 GGCTGGGAAAGGTCAGGGAAGGG + Exonic
954700443 3:52447988-52448010 GTCCAGGGAAGCTCAGACAAGGG - Intergenic
955442683 3:58974250-58974272 GTAGGGGGAAGGTGGGAGGACGG - Intronic
955571828 3:60315405-60315427 GTCTGGGTAGGGTCAGAGAGAGG - Intronic
956505149 3:69929979-69930001 GGCGGGGGTAGGTCAAAAAATGG - Intronic
957628842 3:82692427-82692449 GCCGGGGGAAGGGGAGAAAATGG - Intergenic
961191728 3:124968041-124968063 GATGGGGGAAGGTGAGAGGAAGG - Exonic
963189462 3:142453390-142453412 GTGAGGGGAGGGTAAGAGAAGGG + Intronic
963599473 3:147365193-147365215 GGTGGGGGAAGGTGAGAGGAGGG + Intergenic
963854372 3:150238713-150238735 GTGTGGGGAAGGCCATAGAAAGG + Intergenic
963955683 3:151251140-151251162 GGCAGGGCAAGGGCAGAGAAAGG - Intronic
964586163 3:158305140-158305162 GATTGGGGAAGGGCAGAGAAGGG - Intronic
966193231 3:177290027-177290049 GTGGGGGGATGGGCAGATAAGGG - Intergenic
966895915 3:184444948-184444970 GTCTGGAGAAGGAAAGAGAAGGG - Intronic
967282760 3:187837859-187837881 GTCTAGGGAAGGTGAGAAAAGGG + Intergenic
967991811 3:195137128-195137150 GTGGGGGCCAGGACAGAGAAGGG + Intronic
968424937 4:517012-517034 TTCAGGGGATGGTCAGAGCAGGG + Intronic
969397769 4:6933820-6933842 GGCAGGGGAAGGGCAGAGCAGGG + Intronic
969475861 4:7422194-7422216 GACAGGAGAAGGTCAGAGAATGG - Intronic
969616777 4:8257808-8257830 GACTGGGGAAGGGTAGAGAAAGG - Intergenic
969620229 4:8275245-8275267 GTCGGGGGAAGACCACAGGATGG - Intronic
970530029 4:16972006-16972028 GTGGGGGGAAGGTGAGAGTGAGG + Intergenic
971344138 4:25796906-25796928 GACGCGGGAAGGACAGGGAATGG + Intronic
971422626 4:26488150-26488172 GTTGGGAGAAGGGCAGAGATGGG - Intronic
973639383 4:52887810-52887832 GTTGGGGGATGGTAAGAGAAAGG - Intronic
973726308 4:53780308-53780330 GCCCAGGGAAGCTCAGAGAAAGG - Intronic
974611701 4:64226900-64226922 CTAGGGAGAAGGACAGAGAAAGG - Intergenic
979943274 4:126790844-126790866 GTCCAGGGAAGGCCAGAGGAAGG - Intergenic
980038725 4:127914749-127914771 GGCGGGGGAAGGACATGGAAAGG - Intergenic
981824787 4:148927367-148927389 GTTGTGGGAAGGCCAGAAAATGG + Intergenic
981904121 4:149901015-149901037 GTAGGGGGAGGGTAAGAGGAGGG + Intergenic
983103709 4:163658790-163658812 GTCGGGGGAATGTGGGAGGAGGG + Intronic
984043917 4:174773789-174773811 TTTGGGGGAAGGGAAGAGAAGGG - Intronic
984065100 4:175037922-175037944 CTCGGGAGAAGGACAGAGAAAGG + Intergenic
984317853 4:178150786-178150808 GTCAAGGGAAGTTCAGAAAATGG - Intergenic
985011896 4:185591376-185591398 TTATGGGGAAGGGCAGAGAAAGG + Intronic
985658834 5:1145529-1145551 GTCCTGGAAAGGTCAGTGAAGGG - Intergenic
986847850 5:11776433-11776455 GTTTGTGGAGGGTCAGAGAAGGG + Intronic
987017300 5:13833677-13833699 GCTGTGGGAATGTCAGAGAAAGG + Intronic
987294355 5:16537009-16537031 GTCAGGGGAAGAGTAGAGAAGGG - Intronic
987620732 5:20336332-20336354 CTCAGGAGAAGGACAGAGAAAGG + Intronic
988263538 5:28922197-28922219 GTAGGGGGAGGGAGAGAGAAAGG - Intergenic
988281774 5:29157712-29157734 GTTGGGTGAGAGTCAGAGAAAGG - Intergenic
993125474 5:83830323-83830345 GACGGGGGAAGGTGCGAGGAGGG - Intergenic
993695725 5:91059425-91059447 GTAGGGGGAAGGACAGAGTGAGG - Intronic
994045831 5:95308842-95308864 GGCAGGAGAAGGTCAGAGAGAGG - Intergenic
994438463 5:99769224-99769246 CTTGGGAGAAGGACAGAGAAGGG + Intergenic
995085948 5:108109278-108109300 TTCAGGGGAAGGTCAGAAAAAGG - Intronic
995446951 5:112255063-112255085 TTAGGGGGAAGGAAAGAGAACGG - Intronic
996009682 5:118468201-118468223 ATAGGGGGAAGGGAAGAGAAAGG - Intergenic
998140807 5:139698290-139698312 GCCGGCTGAAGGTCAGAGAGTGG - Intergenic
998452829 5:142247804-142247826 AGCAGGGGAAGGACAGAGAAAGG - Intergenic
999319796 5:150606839-150606861 GTTGGGGGCAGGTCAAGGAAAGG - Intronic
999942735 5:156562281-156562303 GTTTGGGGAAGGTTATAGAATGG + Intronic
1000203850 5:159038294-159038316 GGCAGGGCAAGGTCAGAGTAGGG - Intronic
1000263338 5:159611314-159611336 GTAAGGGGAAGGGCAGGGAAGGG - Intergenic
1001348999 5:170938045-170938067 GGAGGGAGGAGGTCAGAGAAAGG - Intronic
1001822547 5:174721236-174721258 GGCGGGGGAGGGGCAGCGAAGGG - Intergenic
1002211831 5:177604098-177604120 CTCGTGGGGAGGCCAGAGAACGG + Intronic
1003455149 6:6275194-6275216 CTCGGGGGAAGGTAAGTGGAGGG + Intronic
1003592562 6:7448141-7448163 GTTGGGGGTTGGACAGAGAAAGG - Intergenic
1003640600 6:7872085-7872107 GTCAAGGGCAGGGCAGAGAAAGG - Intronic
1004030023 6:11859400-11859422 GTCAGGGGAGGGTGAGAGAGGGG + Intergenic
1004462251 6:15848508-15848530 GTGGGGAGAAGATCAGAGACAGG - Intergenic
1005195123 6:23273550-23273572 CACTGAGGAAGGTCAGAGAATGG + Intergenic
1005871547 6:29977344-29977366 GCCTGGGGCAGGTCAGGGAAGGG - Intergenic
1005972748 6:30774322-30774344 GTCGGGGGCAGGAAAGAGGATGG + Intergenic
1006057935 6:31399707-31399729 GCCGGGAGCAGGTCAGGGAAGGG + Intergenic
1006070318 6:31493917-31493939 GCCTGGGGCAGGTCAGAAAAGGG + Intergenic
1006299501 6:33186106-33186128 GTAGGGGGAAGGGAAGGGAAGGG - Intronic
1010396639 6:75400535-75400557 GTCAGGAGAAGGTTAGAAAAAGG + Intronic
1010994951 6:82522812-82522834 TTCTGGGAAAGGGCAGAGAAGGG + Intergenic
1011558219 6:88590380-88590402 GCTGGGGGAAGTGCAGAGAAGGG + Intergenic
1014179578 6:118370408-118370430 GAGGGGGGAAGGTGAGAGGAGGG + Intergenic
1014472269 6:121831255-121831277 GTTGGGGGATGGTCAGTGAGAGG + Intergenic
1014609131 6:123519279-123519301 GTCAGGGAAAGGTCAGAGTCTGG - Intronic
1016282660 6:142436113-142436135 GTGGGGGGTAGGGGAGAGAAAGG + Intronic
1017210333 6:151848622-151848644 GTCTGGAAAAGGTTAGAGAATGG + Intronic
1019266827 7:121732-121754 GGCAGGGGAAGGGCAGGGAAAGG + Intergenic
1021915282 7:25425644-25425666 GTTGGGGAAGGCTCAGAGAAGGG - Intergenic
1023504516 7:40885954-40885976 GTCGGGGGAAAGGTAAAGAAAGG - Intergenic
1024768668 7:52691625-52691647 GTGGTGGGAAGGGCAGAGGATGG + Intergenic
1026152657 7:67801389-67801411 GTTGGGAGAAGTTCAGAGACTGG - Intergenic
1029183496 7:98721527-98721549 GTTGGGGGAAGTTCAGAGCATGG - Intergenic
1032739481 7:134724364-134724386 TTCAGGGGAAGCTGAGAGAAAGG + Intergenic
1033877718 7:145842807-145842829 CTTGAGGGAAGGACAGAGAAGGG - Intergenic
1036459130 8:8936422-8936444 CTGGGAGGAAGGTCAGGGAAGGG - Intergenic
1037120082 8:15273307-15273329 GTAGTGGGAACATCAGAGAAAGG + Intergenic
1038475956 8:27868220-27868242 GTCGGGGGAAGGAGAGGCAAGGG + Intergenic
1038785989 8:30616733-30616755 GTGGGGGGATGGGCAGGGAATGG + Intronic
1038994281 8:32904117-32904139 CCTGGGGGAAGGACAGAGAAGGG - Intergenic
1041016552 8:53597446-53597468 GTCAGGGAAAGGCAAGAGAAAGG - Intergenic
1041526364 8:58810823-58810845 GTGTGGGGAAGGGCAGCGAAAGG - Intronic
1042978486 8:74498817-74498839 GTGGGGAGCAGGACAGAGAAAGG - Intergenic
1048212558 8:132467506-132467528 GGCAGGGGAAGGACAGAAAAAGG + Intronic
1048294631 8:133205386-133205408 GTCTAGGGAAGGCCAGAGGAGGG - Intronic
1049070034 8:140349203-140349225 GGCGAGGGAAGGGCACAGAAGGG + Intronic
1050766495 9:9141218-9141240 GACGGGGGGAGGAGAGAGAAGGG - Intronic
1051250360 9:15152792-15152814 CCCAGGGGAAGGCCAGAGAAAGG - Intergenic
1053304228 9:36972661-36972683 GCTGGGGGAAAGTCAGAGACAGG + Intronic
1053533554 9:38904824-38904846 GTGGGGCGAGGGGCAGAGAACGG + Intergenic
1054205779 9:62129253-62129275 GTGGGGCGAGGGGCAGAGAACGG + Intergenic
1054632582 9:67459117-67459139 GTGGGGCGAGGGGCAGAGAACGG - Intergenic
1056747920 9:89320448-89320470 GTGGAGGGAAGGGCAAAGAAAGG + Intronic
1060188732 9:121579048-121579070 GTTGGGGGTAGGTCAGGGCAGGG + Intronic
1060301587 9:122377455-122377477 GTGGGGGGGCGGTCAGAAAAGGG - Intronic
1060795501 9:126510033-126510055 CTCTGGGGGATGTCAGAGAAAGG + Intergenic
1061720946 9:132551016-132551038 GTAGGGGGAAAGTAAGACAATGG + Intronic
1186469177 X:9807891-9807913 GTCAAGGGGAGGTCAGAGAGGGG + Intronic
1186765752 X:12769083-12769105 GTAGGGGGTAGGGAAGAGAAGGG + Intergenic
1187126479 X:16458785-16458807 GTCGGGGGAACAACAGACAATGG - Intergenic
1187140777 X:16591702-16591724 AGTGGGGGAAGGTCAGAGGAAGG - Intronic
1187899573 X:24014944-24014966 GTGGGCTGAAGATCAGAGAAAGG + Intronic
1188247261 X:27851397-27851419 GTCAGAGGAAGGTGGGAGAAAGG - Intergenic
1189783859 X:44542404-44542426 GTAGGGTCAAGGTCAGAGCAGGG + Intronic
1190118981 X:47645047-47645069 GCCCGGGGGAGGTGAGAGAAGGG + Intronic
1191820068 X:65296346-65296368 CTCGGGGAAAGGGCAGAGACTGG + Intergenic
1192433468 X:71127820-71127842 GTCGAGGGATGGTCAGGAAAGGG - Intronic
1192809432 X:74536225-74536247 GTCGTGGCGAGGTCAGTGAAGGG - Intergenic
1193400560 X:81037101-81037123 GTGGGGGGAAGGGAAGGGAATGG - Intergenic
1193724952 X:85027196-85027218 GTCGGGGGAGGGAAGGAGAAAGG + Intronic
1193894301 X:87093206-87093228 GTGGGGGGAAGGTGGGAGGAGGG - Intergenic
1194422060 X:93687781-93687803 GTCGGGGGATGGGAAGAGATTGG - Intronic
1195104218 X:101587552-101587574 GAGGGTGGAAGGTCAGAGGAAGG - Intergenic
1195868048 X:109454754-109454776 GTCGGGGGAGGTACAGAGAAGGG - Intronic
1196722141 X:118864460-118864482 GTGGGGGGAGGGTCAGTGAGAGG - Intergenic
1198229843 X:134678409-134678431 GACATGGGAAGGTCAGGGAAAGG - Intronic
1198277881 X:135113226-135113248 GCCTGGGGAAGGTGAGTGAAGGG - Intergenic
1198568388 X:137929550-137929572 GTAGGGGGAGGTGCAGAGAATGG + Intergenic
1198877286 X:141241406-141241428 GGCGGGGGAAGGGAAGGGAAGGG - Intergenic
1198907968 X:141583627-141583649 GGCGGGGGAAGGGAAGGGAAGGG - Intergenic
1198908823 X:141590797-141590819 GGCGGGGGAAGGGAAGGGAAGGG + Intronic
1199005256 X:142688555-142688577 GGAGGGGGAAGGGAAGAGAAGGG - Intergenic
1199078099 X:143546967-143546989 GAAGGGGGAAGGTCAGAGGAGGG + Intergenic
1199386732 X:147231815-147231837 GTCTGGGGAAGGGAAGGGAAAGG + Intergenic