ID: 905804162

View in Genome Browser
Species Human (GRCh38)
Location 1:40863843-40863865
Sequence GGTCGGGGGAAGGTCAGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 526
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 491}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905804162_905804177 30 Left 905804162 1:40863843-40863865 CCTTCTCTGACCTTCCCCCGACC 0: 1
1: 0
2: 1
3: 33
4: 491
Right 905804177 1:40863896-40863918 GGTTTATCCAGTTGATGTAGAGG 0: 1
1: 0
2: 1
3: 6
4: 73
905804162_905804168 -8 Left 905804162 1:40863843-40863865 CCTTCTCTGACCTTCCCCCGACC 0: 1
1: 0
2: 1
3: 33
4: 491
Right 905804168 1:40863858-40863880 CCCCGACCTGTGGCATCCTTGGG 0: 1
1: 0
2: 2
3: 8
4: 86
905804162_905804172 1 Left 905804162 1:40863843-40863865 CCTTCTCTGACCTTCCCCCGACC 0: 1
1: 0
2: 1
3: 33
4: 491
Right 905804172 1:40863867-40863889 GTGGCATCCTTGGGACTTCCTGG 0: 1
1: 0
2: 0
3: 14
4: 167
905804162_905804175 9 Left 905804162 1:40863843-40863865 CCTTCTCTGACCTTCCCCCGACC 0: 1
1: 0
2: 1
3: 33
4: 491
Right 905804175 1:40863875-40863897 CTTGGGACTTCCTGGAACTTGGG 0: 1
1: 0
2: 0
3: 16
4: 230
905804162_905804166 -9 Left 905804162 1:40863843-40863865 CCTTCTCTGACCTTCCCCCGACC 0: 1
1: 0
2: 1
3: 33
4: 491
Right 905804166 1:40863857-40863879 CCCCCGACCTGTGGCATCCTTGG 0: 1
1: 0
2: 1
3: 5
4: 114
905804162_905804174 8 Left 905804162 1:40863843-40863865 CCTTCTCTGACCTTCCCCCGACC 0: 1
1: 0
2: 1
3: 33
4: 491
Right 905804174 1:40863874-40863896 CCTTGGGACTTCCTGGAACTTGG 0: 1
1: 0
2: 0
3: 11
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905804162 Original CRISPR GGTCGGGGGAAGGTCAGAGA AGG (reversed) Intergenic
900343424 1:2199358-2199380 GGGCGGGGGGACGTCAGAGCAGG - Intronic
900432926 1:2611460-2611482 GGGCGGGGCAAGGTCAGGGTGGG + Intronic
900595187 1:3477245-3477267 GGTGGGGGGGAGGGCAGAGTGGG - Intronic
900996199 1:6124796-6124818 GGCCCGGGAAAGGACAGAGAGGG + Intronic
901044308 1:6386262-6386284 GGGGCGGGGAAGGTCAGGGAGGG - Intronic
901417102 1:9124928-9124950 GGGCGGGGGTAGGTTAGTGAGGG - Intronic
901492820 1:9605309-9605331 GCTCTGGGGAGTGTCAGAGAGGG - Intronic
901492832 1:9605363-9605385 GCTCTGGGGAGTGTCAGAGAGGG - Intronic
901788678 1:11641717-11641739 GGTCAGGGGAAGGTCCCAGGGGG + Intergenic
902256188 1:15190115-15190137 GCTTGGGGGCAGGTGAGAGACGG + Intronic
902761791 1:18585901-18585923 GGTGGGGGGAAGCTGGGAGAAGG + Intergenic
903022531 1:20404140-20404162 ACTCTGGGGTAGGTCAGAGATGG + Intergenic
903367967 1:22816551-22816573 GGCAGGGGGAACGGCAGAGATGG - Intronic
903478128 1:23634513-23634535 GGTGGTGGGAGGGTCAGAGATGG + Intronic
903624629 1:24721746-24721768 GGTCGGGGGAGGCTCAGGCATGG - Intergenic
903743705 1:25573092-25573114 GGGCGGGGGGAGGTCAGATGGGG + Intergenic
904327498 1:29736848-29736870 GCTCAGGGGAAGAACAGAGATGG - Intergenic
904348872 1:29892055-29892077 GATCAGGGCAAGGACAGAGATGG - Intergenic
904418771 1:30378239-30378261 TGTCGGGGGAAGGAGAGAGCAGG + Intergenic
904865438 1:33575217-33575239 GGGCTGGGGAAGGAGAGAGAAGG + Intronic
905804162 1:40863843-40863865 GGTCGGGGGAAGGTCAGAGAAGG - Intergenic
906243833 1:44259306-44259328 GGGTGGGGGAAGGGCAGAGGTGG + Intronic
906725254 1:48039861-48039883 GGGCGGGGAGAGGACAGAGAGGG + Intergenic
906898185 1:49802644-49802666 GGGCGGGGGTAGGTTAGTGAGGG - Intronic
906911831 1:49960417-49960439 GGTAGGGAGAAGGGGAGAGATGG + Intronic
907759477 1:57343545-57343567 GGTCGGGGGAGGCTCAGGCATGG + Intronic
909030520 1:70533939-70533961 GGTCTGGTCAAGGTCTGAGATGG - Intergenic
909283474 1:73786437-73786459 GGTCGGGGAAAGGTCAAATATGG - Intergenic
910334203 1:86109714-86109736 GGTTGGGGGAAGATTAGATAAGG - Intronic
910355902 1:86354302-86354324 GGCTGGGGAAAGGGCAGAGATGG - Intronic
910599771 1:89018746-89018768 GGGTGGGGGAAGGTTAGTGAGGG - Intronic
910676562 1:89821612-89821634 GGGCGGAGGGAGGTGAGAGAAGG - Intronic
910831597 1:91467070-91467092 GGGCGGGGGTAGGTTAGTGAGGG - Intergenic
911048762 1:93651767-93651789 GGTAGGGGTAAGGCCAGAGTGGG - Intronic
911425539 1:97706523-97706545 GCTGGGGAGAAGGTGAGAGAGGG - Intronic
912383498 1:109260107-109260129 GGTGGGGGGAAGGGGAGGGACGG + Intronic
913089782 1:115468703-115468725 GGGAGATGGAAGGTCAGAGAAGG - Intergenic
913333685 1:117687720-117687742 GGCTGTGGGAAGGTCAGAGCAGG + Intergenic
913537436 1:119786411-119786433 GGGCGGGGGTAGGTTAGTGAGGG + Intergenic
915083376 1:153367225-153367247 GGTAGAGGGAAGGAGAGAGAAGG + Intergenic
915508477 1:156372327-156372349 TGTAGGGGGAAGGCCACAGATGG - Intronic
915590733 1:156868763-156868785 GGTTGAGGGACGGACAGAGATGG + Intronic
915631236 1:157155244-157155266 GGGCGGGGGAGGGTGAGAGCTGG + Intergenic
916108731 1:161448172-161448194 GGGCGGAGGAAGGAGAGAGAAGG + Intergenic
916110319 1:161455553-161455575 GGGCGGAGGAAGGAGAGAGAAGG + Intergenic
916111904 1:161462963-161462985 GGGCGGAGGAAGGAGAGAGAAGG + Intergenic
916113491 1:161470344-161470366 GGGCGGAGGAAGGAGAGAGAAGG + Intergenic
916531554 1:165661122-165661144 GGAGGGCAGAAGGTCAGAGAGGG + Intronic
916552206 1:165859878-165859900 GGGCAGGGGAGGGCCAGAGAAGG - Intronic
919726606 1:200888564-200888586 GGTCGGGGGAAAGGGAGAGTGGG + Intergenic
920149051 1:203888912-203888934 GCTGGAGGGAAGGTCAGTGAGGG + Intergenic
920182294 1:204139589-204139611 GGTATGGGGAAGGCCAGAGGTGG - Intronic
920432933 1:205930188-205930210 GGGCAGGTGAAGGTCACAGATGG - Intronic
921253246 1:213316954-213316976 GGTGGGGGTGAGGTCAGAGAGGG + Intergenic
921449573 1:215289193-215289215 AGTCAGTGGAGGGTCAGAGATGG - Intergenic
921746360 1:218744187-218744209 GTTTGGGGGAAAGTAAGAGAAGG + Intergenic
922189382 1:223303732-223303754 GGGCAGGGGAAGGTTAGTGAGGG + Intronic
922192603 1:223332785-223332807 GGACAGGGGCAGGACAGAGAAGG - Intronic
922337888 1:224632550-224632572 GGTAGGGGGCAGGTCTGGGAAGG + Intronic
922862777 1:228833540-228833562 GGTAGGGGAAATGGCAGAGATGG - Intergenic
923860014 1:237883721-237883743 GGGCGGGGGAGGGAGAGAGAGGG + Intronic
924283312 1:242460231-242460253 GGGCGGGGGTAGGTTAGTGAGGG - Intronic
1062972166 10:1656494-1656516 GGTTGGGGGAAAGAGAGAGAGGG + Intronic
1062981550 10:1726882-1726904 GGCCCGGGGAAGGACAGCGAGGG + Intronic
1063907955 10:10799575-10799597 GGTAGGGGAGAGGTCAGAGGAGG - Intergenic
1065083257 10:22147918-22147940 GGTCGGGGGAAGATGATAGGAGG - Intergenic
1065704970 10:28464319-28464341 GGTTTGGGGTAGGTCAGTGATGG - Intergenic
1068427062 10:56880430-56880452 GGTCGGTTGAGGGGCAGAGAGGG - Intergenic
1068475032 10:57513866-57513888 GGTAGGGGGAGGTTCGGAGACGG + Intergenic
1069820475 10:71224554-71224576 GGACAGAGGAAGCTCAGAGAGGG - Intronic
1071286970 10:84157972-84157994 GGTTGGGGGAAGAAGAGAGAAGG + Intergenic
1071537951 10:86451836-86451858 GGCCGGGGGAGGGGCAGAGAGGG + Intronic
1071723537 10:88171829-88171851 GGTAGGGGGAAGGAAAGATAAGG - Intergenic
1072732032 10:97852709-97852731 GGTGGGGAGAGGGACAGAGAGGG + Intronic
1073212735 10:101818146-101818168 GGGAGGGGGAAGGGCAGAGGGGG - Exonic
1073348443 10:102801955-102801977 GGTGGGGGGAAGGGTAGGGAAGG - Intronic
1074711542 10:116182103-116182125 GGTGGTGGGGAGGGCAGAGATGG + Intronic
1076483626 10:130801512-130801534 GGATGGGGGAAGGGCAGACAGGG + Intergenic
1076536339 10:131180033-131180055 GGTCGGGAGAAAGACAGACATGG + Intronic
1077178644 11:1202654-1202676 GGGCGGGGGAAAGACAGGGAGGG + Intergenic
1077218424 11:1404730-1404752 GCTTGCGGGAAGGGCAGAGAGGG - Intronic
1077456148 11:2682179-2682201 GGCCTGGGGAAGGGGAGAGAAGG - Intronic
1077897587 11:6465305-6465327 GGTTTGGGAAAGGACAGAGAAGG + Intronic
1077915306 11:6607875-6607897 GCTCAGGGGAAGGTCTGAAATGG + Intronic
1078542314 11:12222217-12222239 GGACGGGGGGAGGTCAGGGCTGG + Intronic
1078692780 11:13598460-13598482 GGGTGGGGGAAGGAGAGAGAGGG + Intergenic
1079237301 11:18699651-18699673 GGTAGGGGCATGGTCAGAGGAGG - Intronic
1079382788 11:19953345-19953367 GGCCGGGGGCAAGTCAGCGAAGG - Intronic
1079718803 11:23784982-23785004 GTTTGGGGGAAGGTTGGAGATGG + Intergenic
1080682153 11:34487130-34487152 GGTTGGGGGAGAGCCAGAGATGG + Intronic
1080959020 11:37136105-37136127 GGGCGGGGGTAGGTTAGTGAGGG - Intergenic
1081689980 11:45071289-45071311 GGAAGCGGGGAGGTCAGAGATGG - Intergenic
1081691235 11:45080100-45080122 GGTGGGGGGAGGGTGAGGGATGG - Intergenic
1083235196 11:61346581-61346603 GGCCGGGGGAAGGTGAGGGTTGG - Exonic
1083707377 11:64525772-64525794 GCTCGGGGGCAGGGCAGAGCTGG + Intergenic
1083741001 11:64711764-64711786 GTTTGGGTGAGGGTCAGAGATGG - Intronic
1083967363 11:66051054-66051076 GGTCGGGGGAAGGTGAGGTTTGG - Intronic
1084667860 11:70586152-70586174 ATTAGGGGGAAGGTCAGGGAAGG + Intronic
1085273455 11:75283703-75283725 GGGAGGGGGAAGGACAGAGCTGG - Intronic
1085381463 11:76123128-76123150 GGGCAGGGGAAGGGCAGAGAAGG - Intronic
1085430165 11:76441210-76441232 GGTCGATGGAAGGACAGAGATGG + Intergenic
1089016965 11:115173254-115173276 GGTGGGGGGGCGGTGAGAGAGGG + Exonic
1089688509 11:120171726-120171748 GGTAGGGGAAGGGACAGAGAAGG + Intronic
1090273088 11:125401536-125401558 GGCCGAGGGATGGCCAGAGAAGG - Intronic
1090320305 11:125837434-125837456 GGGCAGGGGATGGGCAGAGAAGG - Intronic
1091291673 11:134443839-134443861 GGTAGGGGGGATGTCAGAGAGGG - Intergenic
1091491593 12:937272-937294 GGTAGGGGAAAGGTGAGTGAAGG - Intronic
1091546809 12:1506609-1506631 GGTCTGGGGGAGGTCAGAACGGG + Intergenic
1091585200 12:1811896-1811918 GGGTGGGGGAAGAACAGAGACGG + Intronic
1093981129 12:25477019-25477041 GGTCTGGGGATGGGCACAGAGGG - Intronic
1094359979 12:29620234-29620256 GGTGCAGGGAAGATCAGAGAGGG + Intronic
1094405334 12:30110587-30110609 GGTCGGGGGAGGCTCAGGTATGG + Intergenic
1094808241 12:34110906-34110928 GGGCGGGGGTAGGTTAGTGAGGG - Intergenic
1095946477 12:47756618-47756640 GGTAGGGGGAAGGAGGGAGAGGG + Intronic
1095950008 12:47776638-47776660 GGTTGAGGGAAGGTGAGAGGTGG + Intronic
1096412537 12:51387769-51387791 GTTGGGGGAAAGGACAGAGAAGG + Intronic
1097271823 12:57780267-57780289 GGCCAGGGGCAGGTCAGTGATGG - Exonic
1098745006 12:74224986-74225008 GGACGGTGGAAGGTGAGTGAGGG - Intergenic
1099935429 12:89119346-89119368 GGACGGGGGAAGGAGGGAGAGGG - Intergenic
1100523431 12:95398532-95398554 GGTCAGGATAAGGTCAGAGGTGG - Intergenic
1100734258 12:97509600-97509622 GGTCAGGGGAGGGAGAGAGATGG - Intergenic
1101437538 12:104677014-104677036 GGTCGGGAGAAGGTTGGAGAAGG - Intronic
1101835974 12:108295702-108295724 AGGGAGGGGAAGGTCAGAGATGG - Intronic
1101854407 12:108430109-108430131 GGAGGGCTGAAGGTCAGAGAAGG + Intergenic
1102023919 12:109702476-109702498 GCTCAGAGGAAGCTCAGAGAAGG - Intergenic
1102327004 12:111994515-111994537 GGGCGGGGGTAGGTTAGTGAGGG + Intronic
1104006354 12:124895533-124895555 GGTCAAGGGAAGGGGAGAGAGGG + Intergenic
1104537137 12:129628750-129628772 GGTCATGGGAAGATGAGAGAGGG - Intronic
1105673953 13:22650289-22650311 GGGTGGATGAAGGTCAGAGAGGG + Intergenic
1105725666 13:23160160-23160182 CGTCGCGGGAAGGACACAGAGGG + Intergenic
1105843960 13:24279191-24279213 GGTATGGTGAAGGTGAGAGAGGG + Intronic
1107067240 13:36227820-36227842 GGTTGGGGGAAGGTCGGTGATGG - Intronic
1107652609 13:42559990-42560012 GGTCGGGGGAGGCTCAGGCATGG - Intergenic
1109105235 13:58241761-58241783 GGGCGGGGGTAGGTTAGTGAGGG - Intergenic
1109272343 13:60268478-60268500 GGGAGGGGGAAGGGGAGAGAGGG + Intergenic
1109859293 13:68176590-68176612 GGTCAGAAGAATGTCAGAGAAGG - Intergenic
1110249425 13:73364967-73364989 GGGAGGGGGAGGGTTAGAGAAGG + Intergenic
1110751820 13:79123540-79123562 GGTTGGGGGGAGGGCAGGGATGG + Intergenic
1111466661 13:88622352-88622374 TCTCGGGAGAAGGACAGAGAAGG + Intergenic
1112028057 13:95430488-95430510 GGGCGGGGGTAGGTTAGTGAGGG + Intergenic
1112928887 13:104711764-104711786 GTAAAGGGGAAGGTCAGAGAAGG - Intergenic
1114533543 14:23409702-23409724 GGTGGGGGGAAGGCCAGAGCAGG - Intergenic
1115761219 14:36580689-36580711 GGTGGAGGGAAGGTGAGGGAGGG + Exonic
1116223160 14:42113588-42113610 GGCCGGGGGAAGCTCAGGCATGG + Intergenic
1116477585 14:45359319-45359341 GGACAGGAGAAGGTTAGAGAGGG + Intergenic
1117880892 14:60312419-60312441 GGATGGGTGAAGCTCAGAGATGG - Intergenic
1118366509 14:65101869-65101891 GGGCCGGGGAAGGGCGGAGAGGG - Intronic
1118430057 14:65708836-65708858 GGTCGGGGGATGGTGTGGGAGGG + Intronic
1119172657 14:72546689-72546711 GGTCTGGGGAAGGCAGGAGAGGG - Intronic
1119180153 14:72600071-72600093 GGAGGGGGGAAGGACAGGGAAGG - Intergenic
1119226420 14:72947708-72947730 GCTGAGGGCAAGGTCAGAGAGGG + Intronic
1119732156 14:76957762-76957784 GGTCTGGGGAAGGGCAGGGCAGG - Intergenic
1119851375 14:77868958-77868980 GTTCAGGGGAAGTTCAGAGGCGG + Intronic
1120646028 14:87075481-87075503 GGTCGGGGGAGGGAGAAAGAGGG - Intergenic
1121710788 14:96038154-96038176 AGTGGGGGGAAGGGGAGAGAAGG + Intergenic
1122024571 14:98866436-98866458 GGCCGGGGAAATGTCAGAGCAGG - Intergenic
1122031960 14:98918946-98918968 GTTCAGGGGGAGGCCAGAGAGGG - Intergenic
1122353212 14:101109366-101109388 GGCCGGGGGAATGGCAGAGCAGG - Intergenic
1122645243 14:103189494-103189516 GGTCGGGAGAAGATGACAGACGG + Intergenic
1123973175 15:25528100-25528122 AGTCGGTGGAAGGACAGTGATGG + Intergenic
1124231690 15:27951662-27951684 GGCTGGTGGAAGGCCAGAGAGGG - Intronic
1125111888 15:36043793-36043815 GGTCGGGGGAGGGTGGGAGAAGG + Intergenic
1125479783 15:40072203-40072225 GGGCTGGGGAAGGTCAGTGTTGG - Intergenic
1125697596 15:41651937-41651959 GGTGGGGGGAAGAGGAGAGACGG - Intronic
1126716804 15:51526118-51526140 GGGAGGGGGAAGGAGAGAGAGGG + Intronic
1127053416 15:55108360-55108382 GGTTAGGGGAAGGTGGGAGAGGG - Intergenic
1128158028 15:65404022-65404044 GGCTGGGCCAAGGTCAGAGAGGG + Intronic
1128667835 15:69551690-69551712 GGTCGGGATAAAATCAGAGAGGG - Intergenic
1129188056 15:73922583-73922605 GGAGGGGTGAAAGTCAGAGAGGG + Intergenic
1129890374 15:79067806-79067828 GGTGGGGGGCAGGTGGGAGAGGG + Intronic
1130439547 15:83938917-83938939 GGGGGCGGGAAGGTGAGAGAGGG - Intronic
1131639616 15:94277659-94277681 GTTCAGGGGGAGGTAAGAGAGGG + Intronic
1132203305 15:99969778-99969800 GGAAGGGGGGAGGTCAGTGATGG + Intergenic
1132691239 16:1182807-1182829 GGTCTGGGCAACGTCAGAGGAGG - Intronic
1134391894 16:13827713-13827735 GGTCGGAGGAGGGTGAGAGGAGG - Intergenic
1134648853 16:15892455-15892477 GGACAGGAGAAGATCAGAGAGGG - Intergenic
1134807408 16:17137641-17137663 GTTCTGGGGAAGGGCAGAGCAGG - Intronic
1135994461 16:27237777-27237799 GGAGAGGGGAAGGGCAGAGAGGG - Intronic
1136299584 16:29324954-29324976 GGGAGGGGGAGGGGCAGAGAGGG - Intergenic
1136373326 16:29849432-29849454 GGTCAGGGGCAGGGCAGAGAGGG - Intergenic
1137359676 16:47802369-47802391 GGCTGGGGGAAGGTAAGAGGAGG + Intergenic
1137487769 16:48906135-48906157 GGCCGGGGGGAGGTCACAGCAGG - Intergenic
1137533399 16:49298805-49298827 GGACTGGGGTAGGGCAGAGAAGG - Intergenic
1137756571 16:50906832-50906854 GTTAGGGGGAAGGTCAGGGTGGG - Intergenic
1137955428 16:52824533-52824555 GGGAGGGGGAAGGTGAGGGAGGG - Intergenic
1138267191 16:55668081-55668103 GGTGGGGGGCAGGGCAGAAAGGG - Intronic
1138344140 16:56309509-56309531 GGTGGGGACAAGGACAGAGAAGG + Intronic
1139285895 16:65813840-65813862 GGGCGGGGGTAGGTCAGTGAGGG - Intergenic
1139442330 16:66974492-66974514 GGTGGGGGGAGGGTCAGGCATGG - Exonic
1139545329 16:67647200-67647222 GTTCGGGGTAAGGGCAGGGAGGG + Intronic
1141652945 16:85403208-85403230 GTGCGGGGGAGGGTAAGAGAGGG + Intergenic
1142255034 16:89009593-89009615 GGTCTGGGGAAGTTCTTAGAGGG + Intergenic
1143118606 17:4594040-4594062 GATGGGGGGAAGGTCTGAGCAGG + Intronic
1145241939 17:21245236-21245258 GGTGAGGGGAAGGGCAGAGATGG + Intronic
1145265601 17:21378254-21378276 TGGCGGGCGAGGGTCAGAGAGGG + Intronic
1145792856 17:27638597-27638619 GGGCGTGGGATGGTCAGAGTTGG + Intronic
1145807722 17:27746466-27746488 GGGCGTGGGATGGTCAGAGTTGG + Intergenic
1146102607 17:29998597-29998619 GCTTGGGGGAAGGTCTGGGATGG + Intronic
1146178119 17:30679622-30679644 GGACGGGGGGAGGACAGAGGAGG + Intergenic
1146952766 17:36918343-36918365 GGTGGGGGGCAGGTCAGGAAAGG + Intergenic
1147444074 17:40464189-40464211 GTTCAGGGGAAGGGAAGAGATGG + Intergenic
1147948190 17:44092312-44092334 GGTCGGGGGTAGTTCACAGCAGG - Intronic
1148183385 17:45622886-45622908 GATGGGAGGAAGGACAGAGAAGG + Intergenic
1148265467 17:46222805-46222827 GATGGGAGGAAGGACAGAGAAGG - Intronic
1148732383 17:49845354-49845376 GTTCAGGTTAAGGTCAGAGAGGG - Intronic
1148764105 17:50027507-50027529 GGTTGGAGGAAGAACAGAGACGG - Intergenic
1149645652 17:58239638-58239660 GATAGGGGGAAGGCCTGAGAAGG - Intronic
1149777739 17:59371246-59371268 GGAAGGGGGAAGGTCGGAGGTGG + Intronic
1150283718 17:63943973-63943995 GGAAGCGGGAGGGTCAGAGATGG + Intronic
1150385921 17:64760063-64760085 GGTGGGGGGAAGGGTTGAGAAGG - Intergenic
1150648878 17:66997091-66997113 GGGAGGTGGAAGGTCAGTGATGG + Intronic
1150672327 17:67211881-67211903 GGAAGGGGGAAGGTAAGGGAAGG + Intronic
1151260584 17:72912857-72912879 GATGGGGAGAAGGTCAAAGAAGG - Intronic
1151272926 17:73011041-73011063 GGTGGGGGCAAGGGCACAGATGG - Intronic
1151330099 17:73401593-73401615 GGGCTGGGAAAGGTCAGAGCTGG - Intronic
1152362130 17:79837621-79837643 GGGCGGGGCAAGGCCAGGGAAGG - Intronic
1152453082 17:80395942-80395964 GGGAGGGGGAAGGTCAGGGTTGG - Exonic
1152477264 17:80526441-80526463 TGAGGGGGGAAGGGCAGAGAGGG - Intergenic
1152875364 17:82783506-82783528 GGGCTGGGGAAGGTGAGGGACGG - Intronic
1153158958 18:2181026-2181048 GGTAGGAGGAAGGTGAGATATGG + Intergenic
1153462874 18:5356105-5356127 GGTCGGGGGAAGGCAAGATGGGG - Intergenic
1153626098 18:7023613-7023635 GGTCAGGGGTGGGTCAGAGTTGG - Intronic
1153800766 18:8666413-8666435 GGTCGGGGGACTTGCAGAGATGG - Intergenic
1155854964 18:30821614-30821636 GGTCATTGGAAGGTTAGAGAAGG + Intergenic
1155860947 18:30898713-30898735 TGTCGTGGGATGGGCAGAGAGGG + Intergenic
1156327549 18:36087760-36087782 TGTTGGGGGAAGGTCAGGAAGGG + Intergenic
1156581292 18:38379525-38379547 GGTCGGGAGAAGGGAGGAGAGGG + Intergenic
1157333728 18:46722006-46722028 TGTCGGGAGAAGGCCATAGAAGG + Intronic
1157383821 18:47246676-47246698 GGGCGGGGGCAGGTCCGAGCCGG + Intronic
1158587615 18:58755308-58755330 TGTTGGGGGAAGGTCAGATAGGG + Intergenic
1159118760 18:64145356-64145378 GGGCGGGGGTAGGTTAGTGAGGG - Intergenic
1159313530 18:66740113-66740135 GGTCGGGGGGAGGTGGGAGGGGG + Intergenic
1160519079 18:79494231-79494253 GGCCGGGGGAAGGCGAGAGCGGG + Intronic
1160519111 18:79494327-79494349 GGCCGGGGGAAGGCGAGAGCGGG + Intronic
1160519175 18:79494519-79494541 GGCCGGGGGAAGGCGAGAGCGGG + Intronic
1160519287 18:79494855-79494877 GGCCGGGGGAAGGCGAGAGCGGG + Intronic
1160519318 18:79494951-79494973 GGCCGGGGGAAGGCGAGAGCGGG + Intronic
1160863452 19:1247519-1247541 GGTCAGGGCTAGGCCAGAGAGGG - Intergenic
1161066540 19:2241291-2241313 GCTCGGGGGAACGTGTGAGAAGG - Intronic
1161203422 19:3028537-3028559 GGTCTGGGGACAGTCAGAGCTGG - Intronic
1161703503 19:5807002-5807024 GGGCTGGGGAAGCTCAGAGTGGG + Intergenic
1161829995 19:6595881-6595903 GTTCTTGGGAAGGTCAGAAAAGG - Intronic
1161956598 19:7499380-7499402 GGGCGGGGGAGGGGGAGAGAAGG + Intronic
1162110580 19:8397692-8397714 GGCCAGGGGAAGGGCAGAGGAGG + Intronic
1162288988 19:9764540-9764562 GGGCGGGGGTAGGTTAGTGAGGG - Intronic
1162320575 19:9968850-9968872 GGTCAAGGGATGGTCAGAGTAGG + Intronic
1162345731 19:10117002-10117024 GGTTGGGGGGAGCTCAGAGGCGG + Intronic
1162924517 19:13923504-13923526 AGTCGAGGGAAGGGAAGAGAGGG - Intronic
1163188284 19:15656064-15656086 GGGTGGGGGAGGGACAGAGAAGG - Intronic
1163379458 19:16955466-16955488 GGCTGGGGGAAGGGAAGAGAGGG + Intronic
1163570938 19:18081969-18081991 GGTGGGGGGTTGGTCAGTGAAGG - Intronic
1163597259 19:18227355-18227377 GGCCTGGGGAATGTCAGAGCAGG - Intronic
1163609344 19:18292905-18292927 GGGCGGGGGAAAGGGAGAGAGGG - Intergenic
1165149721 19:33753615-33753637 GGTGGGGGGATGGTGGGAGATGG - Intronic
1165239037 19:34448638-34448660 GGTTGGGGGAGGGTAGGAGAAGG + Intronic
1165566804 19:36736683-36736705 GGGCGGGGGTAGGTTAGTGAGGG - Intronic
1165728500 19:38129280-38129302 TGTTGGGGGAAGGTCTGAGGAGG + Intronic
1166120382 19:40682848-40682870 GGAGGGGGCAAGGTCAGACAGGG - Intronic
1166519511 19:43471109-43471131 TTTCAGGGGAAGTTCAGAGAGGG - Intergenic
1166827933 19:45621072-45621094 GGTCAGGGCCAGGTCAGAGAAGG + Intronic
1166874965 19:45891393-45891415 GGTAGGGGGGAGGTGAGGGAAGG - Intronic
1167148486 19:47695981-47696003 GGCCGGGAGAAGCTCAGAGATGG + Intronic
1167508239 19:49882336-49882358 TGGCGGGGGAAGGTCGGAGGCGG - Exonic
1167568436 19:50271714-50271736 AGGGGGAGGAAGGTCAGAGAAGG + Intronic
1167732739 19:51270821-51270843 GGTTGGAGATAGGTCAGAGATGG + Intergenic
926217872 2:10916132-10916154 GAGCGGGGGAAGCTCAGGGAGGG + Intergenic
927142420 2:20139569-20139591 GGTTGGGGTGAGGTCAGAGTGGG + Intergenic
927484919 2:23481961-23481983 GGCTGGGGGGAGATCAGAGATGG + Intronic
928112698 2:28523591-28523613 GGTTGGGGGAAGGGCTCAGAGGG - Intronic
930235422 2:48884578-48884600 GGTCGGGGGAAGGTAGGACTGGG - Intergenic
931580216 2:63763867-63763889 GTTGGGGGGAGGGTCACAGATGG + Intronic
935071478 2:99698118-99698140 GCTGGTGGGAAGTTCAGAGATGG - Intronic
935248298 2:101238493-101238515 GGGCGGGGGTAGGTTAGTGAGGG - Intronic
935248959 2:101244887-101244909 GGGCGGGGGTAGGTTAGTGAGGG - Intronic
935264989 2:101386809-101386831 AGTCGGGGGAGGGTCGGAGAGGG - Intronic
937552599 2:123112912-123112934 GGGCGGGGGTAGGTTAGTGAGGG + Intergenic
938086301 2:128404384-128404406 GATGGAGGGAAGGTCAGGGAGGG - Intergenic
938403266 2:131011872-131011894 GGGCGGCGGAGGGGCAGAGATGG + Intronic
939268938 2:139912833-139912855 GGGCGGGGGTAGGTTAGTGAGGG + Intergenic
940559710 2:155280498-155280520 GTTTGGGGGAATGTAAGAGAAGG - Intergenic
940844480 2:158625016-158625038 GGTCGGGGGTCGGTCACTGACGG - Exonic
942658883 2:178243512-178243534 GGTCGGGGGGAGTGCAGTGAAGG - Intronic
943232766 2:185276432-185276454 GGGCGGGGGTAGGTTAGTGAGGG - Intergenic
943314965 2:186375820-186375842 GGGCGGGGGTAGGTTAGTGAGGG - Intergenic
943318186 2:186414237-186414259 GGTCAGGGGTAGGTCAGGGAGGG + Intergenic
943596066 2:189858013-189858035 AGTTGGGGGAAGGTGAGGGATGG + Intronic
943896705 2:193371529-193371551 GGTAGGGTGAAGTTCAGAGCAGG - Intergenic
943906094 2:193502548-193502570 GGGCGGGGGAAGCTCAGGCATGG + Intergenic
943956804 2:194202140-194202162 GGGGGGGGGAAGGTAGGAGAGGG - Intergenic
945069663 2:205977448-205977470 GGTCGGGGGAGGCTCAGGCATGG - Intergenic
946193870 2:218021957-218021979 GAGCGGGGGAAGGGCAGAGGGGG + Intergenic
946719836 2:222592917-222592939 TGTCCTGGGGAGGTCAGAGAGGG - Intronic
947752185 2:232538897-232538919 GTGAGGGGGAAGGTCAGCGAGGG + Intergenic
947987150 2:234458473-234458495 GGCGGGGGGAAGGAGAGAGAGGG - Intergenic
948578535 2:238969290-238969312 GATCAGGGGAAGGTCTGGGAAGG - Intergenic
948789950 2:240372073-240372095 GGGTGGGTGAAGGGCAGAGAAGG - Intergenic
1168847684 20:956689-956711 GGTGGGGGGAACTGCAGAGAGGG + Intergenic
1172094207 20:32452766-32452788 AGTCGGGAGAAGGGCAGAGGGGG - Intronic
1172111498 20:32547980-32548002 GGTTGGGGGAAGGTCAGGGAAGG - Intronic
1172480795 20:35270218-35270240 GGTCGGGGGAGGGTGTGGGAGGG + Intronic
1172592521 20:36127754-36127776 GGGCCATGGAAGGTCAGAGAGGG - Intronic
1172605998 20:36214463-36214485 GGCAGGGGGCTGGTCAGAGAGGG - Intronic
1173190981 20:40875424-40875446 GGGCGGGGGAAGCTCAGGGAGGG - Intergenic
1173971843 20:47159292-47159314 GGTTTTGGGAAGGTCACAGATGG - Intronic
1174919291 20:54684398-54684420 GGTAGGGGGAAGGCTGGAGAGGG + Intergenic
1175585846 20:60139114-60139136 GTTCTGAGGTAGGTCAGAGAGGG - Intergenic
1176092544 20:63325534-63325556 GGGTGGGGGAAGGACAGGGATGG + Intronic
1176114943 20:63428140-63428162 GTTCGGGGGACGGGCAGAGAGGG - Intronic
1179091007 21:38265830-38265852 GTTCCAGGGAAAGTCAGAGAGGG + Intronic
1180159752 21:45993703-45993725 GGTCGGGGGGACGTCAAAGCAGG + Intronic
1180731304 22:17984521-17984543 GGTGGGGGGGAGGTCTGGGAAGG - Intronic
1181181572 22:21072377-21072399 GGGCGGGGGTAGGTTAGTGAGGG - Intergenic
1181727913 22:24824406-24824428 GGTGTGGGGAAGGGGAGAGACGG - Intronic
1181856078 22:25782492-25782514 GATTTGGGGAAGGGCAGAGATGG - Intronic
1182480733 22:30607142-30607164 GGGCGGGGGAAGGTCTGTGGTGG - Exonic
1183173241 22:36203325-36203347 GGGCGGGGGTAGGTTAGTGAGGG + Intronic
1183232939 22:36594135-36594157 GTTGGGAGGAAAGTCAGAGATGG - Intronic
1183501334 22:38181429-38181451 GGTCGGGGAAAGAGAAGAGATGG + Intronic
1183638770 22:39080895-39080917 GGTCAGGGCAAGCTCTGAGAGGG - Intronic
1183646024 22:39127241-39127263 GGTGGGGGAAGGGTCAGAGGAGG - Intronic
1183734125 22:39634528-39634550 GGTGGAGGGATGGTCAGACAGGG - Intronic
1183960764 22:41410565-41410587 GGCAGGGGGTAGGGCAGAGAGGG + Intergenic
1184127503 22:42498474-42498496 GGTCGGGGGTAGGTTAGTGAGGG + Intergenic
1184129488 22:42509272-42509294 GGAAGGAGGAAGGTCAGAGGAGG + Intergenic
1184139689 22:42571365-42571387 GGAAGGAGGAAGGTCAGAGGAGG + Intronic
1184662367 22:45971243-45971265 GGGAGGGGGAAGGGAAGAGAAGG + Intronic
1184667820 22:45997807-45997829 GGTGGGTGGAAGGACAGGGAGGG - Intergenic
1185110153 22:48896264-48896286 GATGGGGTGAAGGGCAGAGAGGG + Intergenic
949663315 3:6307126-6307148 GGGCGGGGGTAGGTTAGTGAGGG + Intergenic
949840100 3:8311113-8311135 GGTGGGGGGAAGGTGGGAGATGG - Intergenic
950263397 3:11558441-11558463 GGTGGGGGGAAGGGAAGGGATGG - Intronic
950429930 3:12944870-12944892 GGTCGGGGGCAGCACAGTGAGGG - Intronic
950624090 3:14231607-14231629 GGTTGGGGGCAGGTCAGGTAGGG - Intergenic
950668089 3:14509328-14509350 GGTGAGGTGGAGGTCAGAGATGG - Intronic
951011192 3:17682032-17682054 GGTGGGGGGAAGGGTAGGGATGG - Intronic
952608083 3:35173740-35173762 GGGCGGGGGTAGGTTAGTGAGGG - Intergenic
952836152 3:37603888-37603910 GGGCTGGGGAAGGGCAAAGAGGG + Intronic
953120687 3:40038714-40038736 GGACAGGGGAAGGAGAGAGAGGG + Intronic
953357881 3:42269788-42269810 GGTGGTGGGAAGGACACAGAGGG - Intergenic
953636546 3:44669866-44669888 TGTTGGGGGAAGGAAAGAGAAGG + Intergenic
953881207 3:46692368-46692390 GGAAGGGGGAAGGTTAGGGATGG - Intronic
953923658 3:46969195-46969217 GGTTGGGGGAGGGTAAAAGAGGG - Intronic
954687297 3:52377808-52377830 GGTCCGGGGAGGGCCAGAGTTGG - Intronic
954700444 3:52447989-52448011 GGTCCAGGGAAGCTCAGACAAGG - Intergenic
954953247 3:54493471-54493493 GGTGGGGGCCAGGGCAGAGAAGG - Intronic
955632642 3:60991100-60991122 GGTGGAGGGGCGGTCAGAGAGGG + Intronic
955959737 3:64327955-64327977 GTTGGGGGGAAGGACAGAGGAGG - Intronic
957919647 3:86731590-86731612 GGTCGGGGGAGGGTCAGGCATGG + Intergenic
959261751 3:104090870-104090892 GGGCGGGGGTAGGTTAGTGAGGG - Intergenic
959571984 3:107894595-107894617 GGTAGGTAGAAGGTGAGAGAAGG + Intergenic
959750735 3:109831595-109831617 GGTCGCAGGCAGGTCCGAGAGGG - Intergenic
960199382 3:114812792-114812814 GGTCGGGGGAGGCTCAGGCATGG + Intronic
960947004 3:122973805-122973827 GGAGTGGGGAAGGGCAGAGAGGG + Intronic
961555142 3:127692136-127692158 AGGCAGGGGAAGGGCAGAGATGG - Exonic
963599472 3:147365192-147365214 GGGTGGGGGAAGGTGAGAGGAGG + Intergenic
964586164 3:158305141-158305163 GGATTGGGGAAGGGCAGAGAAGG - Intronic
965192404 3:165548683-165548705 GGGCGGGGGTAGGTTAGTGAGGG - Intergenic
965518690 3:169650683-169650705 GGTTTTGGGAAGGTCATAGAGGG - Intronic
966193232 3:177290028-177290050 GGTGGGGGGATGGGCAGATAAGG - Intergenic
966310252 3:178586221-178586243 GGTCAAGGGAAAGTCAAAGATGG - Intronic
968045346 3:195620829-195620851 GGTCCGGGAAAGGACAGAGAGGG + Intergenic
968063651 3:195746230-195746252 GGTCCGGGAAAGGACAGAGAGGG + Intergenic
968817509 4:2829553-2829575 GGCCCGGGGCATGTCAGAGAAGG - Exonic
969397768 4:6933819-6933841 GGGCAGGGGAAGGGCAGAGCAGG + Intronic
969622195 4:8284221-8284243 GCTCGAGGGAAGGGCAGTGAGGG - Intronic
969704055 4:8782553-8782575 GGGCGGGGACAGATCAGAGAGGG + Intergenic
971233716 4:24821928-24821950 GGATGGGGGAAGGGAAGAGAAGG + Intronic
971422627 4:26488151-26488173 AGTTGGGAGAAGGGCAGAGATGG - Intronic
972181017 4:36465932-36465954 GGGTGGAGGAAGGTCAGATAGGG - Intergenic
974185236 4:58436918-58436940 TGTTGGGGAAAAGTCAGAGAGGG - Intergenic
975273351 4:72465133-72465155 GGTCCTGGGAAGATCTGAGATGG + Intronic
975298347 4:72760335-72760357 GGTTGAGAGAAGGTGAGAGAGGG - Intergenic
975443324 4:74436864-74436886 GGTGGGGGGCAGGGCAGGGAGGG + Intergenic
976317461 4:83673789-83673811 GGGTGGGGGCAGGTCAGAGGAGG - Intergenic
977894755 4:102350760-102350782 GGTTGGAGGAAGGTGAAAGATGG + Intronic
979809816 4:125022332-125022354 GGAGGGCAGAAGGTCAGAGAGGG + Intergenic
982846221 4:160256019-160256041 GGGCGGGGGTAGGTTAGTGAGGG + Intergenic
982854647 4:160365267-160365289 GGGCGGGGGTAGGTTAGTGAGGG - Intergenic
983103708 4:163658789-163658811 GGTCGGGGGAATGTGGGAGGAGG + Intronic
983536510 4:168862996-168863018 GCTCTGGTGAAGGGCAGAGAAGG - Intronic
983915957 4:173290950-173290972 GGTGGGGTGAAGGTGACAGAAGG - Intronic
985658835 5:1145530-1145552 GGTCCTGGAAAGGTCAGTGAAGG - Intergenic
986240312 5:5954785-5954807 GAAGGGGGGAAGGGCAGAGAGGG - Intergenic
986632428 5:9786801-9786823 GGTTGGGGGCAGCTCATAGAAGG - Intergenic
987294356 5:16537010-16537032 GGTCAGGGGAAGAGTAGAGAAGG - Intronic
987351515 5:17026252-17026274 GGGTGGGGGAAGTACAGAGAGGG + Intergenic
987681527 5:21143022-21143044 GGTAGTGGGTGGGTCAGAGATGG + Intergenic
989664170 5:43833670-43833692 TGTGGGGGGAAGGGTAGAGATGG + Intergenic
989777485 5:45226232-45226254 GGGGGGGGGGTGGTCAGAGAGGG + Intergenic
990393714 5:55354993-55355015 GGGCGAGGGAAGCTCTGAGAAGG + Intronic
991954041 5:71974344-71974366 GGTTTGGGAAAGGACAGAGAAGG - Intergenic
992705457 5:79386983-79387005 GGGAGGGGGAGGTTCAGAGAGGG - Intronic
992734622 5:79706191-79706213 GGGCGGGGGTAGGTTAGTGAGGG + Intronic
994006266 5:94840920-94840942 GGTGGGGGGAAGGTGAGGAAGGG + Intronic
995632542 5:114149544-114149566 GGGCGGGGGTAGGTTAGTGAGGG + Intergenic
996118408 5:119644311-119644333 GGATGGAGGAAGGTCAGAGGTGG - Intergenic
996301526 5:121992427-121992449 GGTAGCAGAAAGGTCAGAGAAGG - Intronic
997402579 5:133613448-133613470 GGCCGGGGGGAGGTGACAGAGGG + Intergenic
997554934 5:134787906-134787928 GGTGGGGGGAGGGGCTGAGATGG + Intronic
998350481 5:141497210-141497232 GGGGGGGGGAAGATCAGAGAAGG + Intronic
998367193 5:141639116-141639138 GGTTGGGGGAAGGGCAAAGCTGG + Intronic
998405846 5:141874375-141874397 GGCCCGGGGAAGGGCAGATAAGG - Intronic
998444251 5:142186369-142186391 GGTTGGGGGAGGTTCAGAGGGGG + Intergenic
998885242 5:146687066-146687088 GGTGGGGGGAGGGAGAGAGAGGG + Intronic
999076980 5:148805848-148805870 GGGCGGGGGAAGTTCACTGAAGG + Intergenic
999682514 5:154073183-154073205 GGGCGGGGGTAGGTTAGTGAGGG + Intronic
999735506 5:154510054-154510076 GGGCGTGTGAAGGGCAGAGAGGG + Intergenic
1000210017 5:159100155-159100177 GGTGGGGGGAAGGGGAGAGAGGG + Intergenic
1000263339 5:159611315-159611337 GGTAAGGGGAAGGGCAGGGAAGG - Intergenic
1000342574 5:160289135-160289157 GGTAGGAGGGAGGTCAGGGATGG - Intronic
1000400874 5:160825800-160825822 GGTCAGGGGAAGGGCGGAGGTGG - Intronic
1001043424 5:168353246-168353268 AGTAGGGGGAAGGTCAGTCATGG - Intronic
1001802723 5:174558227-174558249 GTTGGGGGGAAGGGAAGAGATGG - Intergenic
1001822548 5:174721237-174721259 GGGCGGGGGAGGGGCAGCGAAGG - Intergenic
1001854692 5:175000684-175000706 GGACCGGGGAAGATCAGAGCAGG - Intergenic
1002075550 5:176706187-176706209 GGCTGGGGGAAGGGCAGAGGAGG + Intergenic
1002105940 5:176879491-176879513 GGGCGGGAGAGGGGCAGAGAGGG + Intronic
1003578061 6:7315441-7315463 GGTTGGGGGAGGCTCAGACATGG - Intronic
1003618665 6:7678039-7678061 GGAGAGGGGTAGGTCAGAGACGG - Intergenic
1004030022 6:11859399-11859421 CGTCAGGGGAGGGTGAGAGAGGG + Intergenic
1004220387 6:13741890-13741912 GATGGGGGGAAGGCCAGGGAAGG + Intergenic
1005752038 6:28892373-28892395 GGTTGGGGGAGGCTGAGAGATGG + Intergenic
1005824919 6:29627106-29627128 GGTGGAGGGAATGTCAGAGGTGG - Intronic
1006803970 6:36776833-36776855 GTTAGGAGGAAGGTCAGTGAGGG - Intronic
1006915880 6:37593728-37593750 GGTCTGGGGGACATCAGAGATGG + Intergenic
1008507588 6:52246017-52246039 GGGCAGGAGAAGTTCAGAGAGGG + Intergenic
1010902157 6:81441403-81441425 GGGCGGGGGTAGGTTAGTGAGGG - Intergenic
1011558218 6:88590379-88590401 GGCTGGGGGAAGTGCAGAGAAGG + Intergenic
1011898698 6:92264524-92264546 GGTCGGGGAGAAGCCAGAGAGGG - Intergenic
1012114745 6:95282017-95282039 GGTTGGGGGAAGGTCATCCAAGG + Intergenic
1012126645 6:95437027-95437049 GCTTGGGGGAAGGACAAAGAGGG - Intergenic
1014164544 6:118208845-118208867 GGGCAGGAGAAGGTCAGAGAGGG - Intronic
1014405822 6:121049135-121049157 GGGCGGGGGTAGGTTAGTGAGGG - Intergenic
1014671730 6:124312953-124312975 GGATGGGAGAAGATCAGAGAGGG + Intronic
1014902063 6:126979198-126979220 GGTCAGAAGAAGGTCAGAAAGGG - Intergenic
1015152017 6:130050504-130050526 GCCTGGGGTAAGGTCAGAGAAGG - Intronic
1015394436 6:132718650-132718672 GGACAGGGTAAGGTCAGAGAGGG + Intergenic
1016512219 6:144856152-144856174 GGTGGGGGGAAGGGCAGATTTGG - Intergenic
1017801552 6:157900597-157900619 GGGCGGGGGTAGGTTAGTGAGGG + Intronic
1018864286 6:167735190-167735212 GGTCGGCGGAAGGTCAGCGGGGG - Intergenic
1018956590 6:168414170-168414192 GGTTGGGAGAAGGAAAGAGATGG + Intergenic
1019693148 7:2428578-2428600 GGGCGGGGGTAGGTTAGTGAGGG + Intronic
1019707718 7:2504517-2504539 GGTCTGGGAAAGGGCAGACAGGG + Intergenic
1020983560 7:15103216-15103238 TGTGGGGGAAAGGTCAGAGTGGG - Intergenic
1021186889 7:17575446-17575468 GGTTGGGGGAAGGGCCTAGATGG + Intergenic
1022375131 7:29806004-29806026 GGTGGGGAGTAGGTCAGGGAGGG - Intergenic
1022450484 7:30509225-30509247 GGTCAGGGGTAGGTTAGTGAGGG + Intronic
1024512265 7:50213296-50213318 GGTTGGGGGAAGGGCAGGGCAGG + Intergenic
1025735622 7:64144135-64144157 GGGCGGGGGTAGGTTAGTGAGGG + Intronic
1026743198 7:72991449-72991471 GGCGGGGGGAGTGTCAGAGAGGG + Intergenic
1026803063 7:73411902-73411924 GGCGGGGGGAGTGTCAGAGAGGG + Intergenic
1026865620 7:73822409-73822431 GGGAGGGGACAGGTCAGAGAGGG + Intronic
1027029312 7:74876146-74876168 GGCGGGGGGAGTGTCAGAGAGGG + Intergenic
1027100537 7:75373629-75373651 GGCGGGGGGAGTGTCAGAGAGGG - Intergenic
1028181760 7:87732717-87732739 GGGCGGGGGTAGGTTAGTGAGGG + Intronic
1028316082 7:89404914-89404936 GGTGGGGGAAAGGGGAGAGAGGG + Intergenic
1028316093 7:89404938-89404960 GGGAGGGGGAAGGGGAGAGAGGG + Intergenic
1028707751 7:93870054-93870076 GGGCGGGGGTAGGTTAGTGAGGG + Intronic
1029464809 7:100718833-100718855 GGGCGGGGGTAGGTTAGTGAGGG - Intergenic
1030675067 7:112375835-112375857 GGTGGGTGGAAGGATAGAGAGGG - Intergenic
1033569336 7:142612223-142612245 GGTCGGGGGGAGGGGGGAGAGGG + Intergenic
1033877719 7:145842808-145842830 GCTTGAGGGAAGGACAGAGAAGG - Intergenic
1034199316 7:149272881-149272903 GGTTGGGGGAAGGTGCGAGGGGG - Intronic
1035619277 8:1025255-1025277 GGTCGGGGGAGTGTGAAAGAGGG - Intergenic
1036089733 8:5652647-5652669 GGTGGAGGGAAGGTTAAAGAGGG + Intergenic
1038475955 8:27868219-27868241 GGTCGGGGGAAGGAGAGGCAAGG + Intergenic
1038500052 8:28036302-28036324 GGGCAGGGGAGGGGCAGAGAAGG - Intronic
1038707726 8:29910406-29910428 AGCCAGGGGAAGGACAGAGAAGG + Intergenic
1038994283 8:32904118-32904140 GCCTGGGGGAAGGACAGAGAAGG - Intergenic
1039270053 8:35870152-35870174 GGTCGGGGGAAGGTTGGGAAGGG - Intergenic
1041066805 8:54090562-54090584 GGGCGGGGGTAGGTTAGTGAGGG - Intronic
1041296344 8:56361228-56361250 GGGCGGGGGTAGGTTAGTGAGGG - Intergenic
1043514905 8:80986806-80986828 GGAGGGGGGAGGGTCAGAGAGGG + Intronic
1043888555 8:85631045-85631067 GGAGGGAGGAAGGGCAGAGAGGG - Intergenic
1045459014 8:102411563-102411585 GGTGGGGGGAAGGTGATAGTTGG - Intronic
1047451159 8:124966252-124966274 GGGCGGGGGTAGGTTAGTGAGGG - Intergenic
1048456694 8:134584785-134584807 GGCCGGGGGAAGGGGAAAGAGGG + Intronic
1048837953 8:138539076-138539098 GGGTGCTGGAAGGTCAGAGATGG + Intergenic
1049070033 8:140349202-140349224 GGGCGAGGGAAGGGCACAGAAGG + Intronic
1049170423 8:141157257-141157279 GGTCAGGGGAGGGTGAGAGGAGG + Intronic
1051657546 9:19397328-19397350 GGTTGGGGGAAGGTGGGAGGTGG + Intergenic
1056796161 9:89660244-89660266 GGTCAGGGCACTGTCAGAGAAGG - Intergenic
1057168908 9:92949137-92949159 GATCTGGGGGAGGTCAGAGCAGG + Intronic
1057178031 9:93013456-93013478 GGTCAGGGGAAGGTGACATATGG + Intronic
1057874865 9:98746300-98746322 GGTGGAGGGAAGGTCAGAAGTGG + Intronic
1058191366 9:101920130-101920152 TGTGGGGAGAAGGTGAGAGAAGG + Intergenic
1058382635 9:104394711-104394733 GGTCAGGGGTAGGTTAGTGAGGG + Intergenic
1059114893 9:111592445-111592467 GGGCGGGGGTAGGTTAGTGAGGG - Intronic
1059328613 9:113520338-113520360 GGTCAGGGAAAGGCCAGAGCTGG - Intronic
1059362243 9:113753932-113753954 GGCTGGGGCCAGGTCAGAGAAGG + Intergenic
1060188731 9:121579047-121579069 GGTTGGGGGTAGGTCAGGGCAGG + Intronic
1060301588 9:122377456-122377478 GGTGGGGGGGCGGTCAGAAAAGG - Intronic
1060823829 9:126676322-126676344 GGTGGGGAGCAAGTCAGAGAAGG - Intronic
1061383797 9:130276392-130276414 GGGTGGGGGAGGGTCAGAGCAGG + Intergenic
1061486490 9:130923033-130923055 GTTCCGGGGAAGCACAGAGATGG - Intronic
1062050646 9:134444781-134444803 GGGAGGGGGAAGGAGAGAGAGGG - Intergenic
1062366013 9:136209409-136209431 GGTGGTGGGAAGGGCAGGGAGGG - Intronic
1062585451 9:137247473-137247495 GGACAGGGGAAGCTCAGGGATGG - Intronic
1185683211 X:1906076-1906098 GGTCAGGGGAAGGTTATACAGGG + Intergenic
1185782571 X:2862079-2862101 GGAAGTGTGAAGGTCAGAGAAGG + Intronic
1186120447 X:6355409-6355431 GGGCGGGGGTAGGTTAGTGAGGG + Intergenic
1186140540 X:6567281-6567303 GGGCGGGGGTAGGTTAGTGAGGG + Intergenic
1186158035 X:6746197-6746219 GGGCTGGGTAAGGTCAGAGTTGG - Intergenic
1186201172 X:7156813-7156835 GGTTGGGGGCAGATCAAAGAAGG - Intergenic
1186469176 X:9807890-9807912 TGTCAAGGGGAGGTCAGAGAGGG + Intronic
1186583777 X:10849733-10849755 GGTTGTGAGAAGGACAGAGAAGG + Intergenic
1186971397 X:14848817-14848839 GGGCGGGGGTAGGTTAGTGAGGG - Intronic
1188975021 X:36662709-36662731 GGGCGGGGGTAGGTTAGTGAGGG - Intergenic
1189909315 X:45794234-45794256 GGTTGGGGGAAGCTGAGAGGAGG + Intergenic
1191269494 X:58445059-58445081 GGGCGGGGGTAGGTTAGTGAGGG + Intergenic
1192433469 X:71127821-71127843 GGTCGAGGGATGGTCAGGAAAGG - Intronic
1193507169 X:82358983-82359005 GGGCGGGGGAAGGGGAGGGAGGG + Intergenic
1194280977 X:91954105-91954127 GGTAGGGGGAAGGGGAGGGAGGG - Intronic
1195506713 X:105666379-105666401 GGGCGGGGGTAGGTTAGTGAGGG + Intronic
1195669085 X:107453911-107453933 GGGCGGGGAAAGGAGAGAGAGGG + Intergenic
1195868049 X:109454755-109454777 TGTCGGGGGAGGTACAGAGAAGG - Intronic
1197944044 X:131819226-131819248 TATCGGAGGAATGTCAGAGATGG - Intergenic
1198122816 X:133610911-133610933 GGTTGGGGGGAGGTGAGAGGGGG - Intronic
1198267675 X:135024511-135024533 GGGCGGGGGTAGGTTAGTGAGGG - Intergenic
1199005257 X:142688556-142688578 GGGAGGGGGAAGGGAAGAGAAGG - Intergenic
1199078098 X:143546966-143546988 AGAAGGGGGAAGGTCAGAGGAGG + Intergenic
1199564893 X:149205573-149205595 GGTCTGGGGCAGGTCAGAGTTGG + Intergenic
1199602812 X:149552695-149552717 GGGCAGGGGAAGGTTAGTGAGGG + Intergenic
1199647577 X:149926780-149926802 GGGCAGGGGAAGGTTAGTGAGGG - Intergenic
1199920485 X:152397641-152397663 GGTCGAGGCAAAGTCATAGATGG - Intronic
1200036673 X:153335404-153335426 GGTTGGGGGAAGGTGAGGGTGGG - Intronic