ID: 905804163

View in Genome Browser
Species Human (GRCh38)
Location 1:40863848-40863870
Sequence TCTGACCTTCCCCCGACCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 126}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905804159_905804163 8 Left 905804159 1:40863817-40863839 CCTCCACGCATTTGACACTCTCT 0: 1
1: 0
2: 0
3: 3
4: 96
Right 905804163 1:40863848-40863870 TCTGACCTTCCCCCGACCTGTGG 0: 1
1: 0
2: 2
3: 11
4: 126
905804158_905804163 9 Left 905804158 1:40863816-40863838 CCCTCCACGCATTTGACACTCTC 0: 1
1: 0
2: 0
3: 7
4: 104
Right 905804163 1:40863848-40863870 TCTGACCTTCCCCCGACCTGTGG 0: 1
1: 0
2: 2
3: 11
4: 126
905804156_905804163 20 Left 905804156 1:40863805-40863827 CCAGAACCTTACCCTCCACGCAT 0: 1
1: 0
2: 0
3: 3
4: 98
Right 905804163 1:40863848-40863870 TCTGACCTTCCCCCGACCTGTGG 0: 1
1: 0
2: 2
3: 11
4: 126
905804155_905804163 21 Left 905804155 1:40863804-40863826 CCCAGAACCTTACCCTCCACGCA 0: 1
1: 0
2: 0
3: 6
4: 92
Right 905804163 1:40863848-40863870 TCTGACCTTCCCCCGACCTGTGG 0: 1
1: 0
2: 2
3: 11
4: 126
905804154_905804163 24 Left 905804154 1:40863801-40863823 CCTCCCAGAACCTTACCCTCCAC 0: 1
1: 0
2: 0
3: 28
4: 278
Right 905804163 1:40863848-40863870 TCTGACCTTCCCCCGACCTGTGG 0: 1
1: 0
2: 2
3: 11
4: 126
905804157_905804163 14 Left 905804157 1:40863811-40863833 CCTTACCCTCCACGCATTTGACA 0: 1
1: 0
2: 1
3: 6
4: 105
Right 905804163 1:40863848-40863870 TCTGACCTTCCCCCGACCTGTGG 0: 1
1: 0
2: 2
3: 11
4: 126
905804160_905804163 5 Left 905804160 1:40863820-40863842 CCACGCATTTGACACTCTCTCTC 0: 1
1: 0
2: 1
3: 12
4: 154
Right 905804163 1:40863848-40863870 TCTGACCTTCCCCCGACCTGTGG 0: 1
1: 0
2: 2
3: 11
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905804163 Original CRISPR TCTGACCTTCCCCCGACCTG TGG Intergenic
900073661 1:794280-794302 GCTGCCCTTCCCCCACCCTGAGG - Intergenic
900679196 1:3907059-3907081 TCTGAGGTTCCCCCGCCCCGCGG + Intergenic
902174097 1:14636388-14636410 TCTCACCTTCCTCTGAGCTGGGG - Intronic
905653618 1:39672187-39672209 TGTGACCTCCCCCCGCCCGGCGG - Intergenic
905804163 1:40863848-40863870 TCTGACCTTCCCCCGACCTGTGG + Intergenic
905972273 1:42151108-42151130 TCTGTCCTTTCCTCGCCCTGTGG - Intergenic
907427358 1:54388858-54388880 TCTAACCTTCCTCAGTCCTGGGG + Intronic
907663316 1:56413524-56413546 TCTGCCTATCCCCAGACCTGTGG - Intergenic
909163254 1:72181870-72181892 TCTGTCCTTCTCCCAACCTCTGG - Intronic
918108383 1:181433191-181433213 TCTTTCCATCCCCCAACCTGGGG + Intronic
922269522 1:224019187-224019209 GCTGCCCTTCCCCCACCCTGAGG - Intergenic
922654210 1:227366617-227366639 TATGATCTGCCCCCTACCTGGGG - Intergenic
1065020859 10:21500718-21500740 TCTGCCCCTCCCCCGTCCTGCGG + Intergenic
1073366454 10:102946231-102946253 TCTGACCCTCCCCCAGCCTCTGG - Intronic
1075650826 10:124127662-124127684 TCTGACCCTCCCTGGCCCTGGGG + Intergenic
1076614955 10:131749121-131749143 GCTGACCTTCACCCGAGCCGAGG + Intergenic
1077226112 11:1439786-1439808 TCACACCTTCCCCTGCCCTGGGG + Intronic
1077226131 11:1439838-1439860 TCACACCTTCCCCTGCCCTGGGG + Intronic
1077226150 11:1439890-1439912 TCACACCTTCCCCTGCCCTGGGG + Intronic
1077518198 11:3015215-3015237 GATGACCTCCCCCTGACCTGTGG + Intronic
1078149439 11:8746204-8746226 TCTTAGCTTCCCCCGATCTAAGG + Intronic
1078320049 11:10326479-10326501 TCTGCCCTTCCCCCTTCCTATGG + Intronic
1078922162 11:15840995-15841017 TCTATCCTTCCCCTGACATGGGG - Intergenic
1081186097 11:40044021-40044043 TCTGCCCCTCCCCCGACCCCAGG - Intergenic
1081722699 11:45301959-45301981 TCTGACCTGCTCCCCACCTGGGG + Intergenic
1082160299 11:48882577-48882599 CCTGACCTTCCCCGGAGCTTTGG + Intergenic
1082162067 11:48897829-48897851 CCTGACCTTCCCCGGAGCTTTGG - Intergenic
1083148592 11:60776064-60776086 TCTGACCTTCCCGAGGCCCGAGG - Exonic
1084030139 11:66476299-66476321 TGTGCCCTTCCCCCCAACTGTGG + Exonic
1084325870 11:68399760-68399782 TCAGGCCTCCCCCAGACCTGGGG - Intronic
1087564363 11:99835423-99835445 TCTGACCTTGCCCAGAGGTGAGG + Intronic
1088789586 11:113212497-113212519 GCTGACCTTCTCCTGACCTGCGG - Intronic
1090895107 11:130964931-130964953 TCTGACCTTACCTGGAACTGAGG - Intergenic
1095136512 12:38611287-38611309 CCTGATGTTCCCCGGACCTGTGG + Intergenic
1096889231 12:54749968-54749990 TCTGACTTTCTCCCTTCCTGTGG + Intergenic
1098826754 12:75306389-75306411 TCTGACCCTCACCAGGCCTGTGG + Intronic
1100233078 12:92629680-92629702 TGTGATCTTTCCCAGACCTGAGG - Intergenic
1102843369 12:116150632-116150654 TCTGACCTCCCACAGAACTGAGG + Intronic
1107926617 13:45269384-45269406 TCTGGCCTACCCCCAGCCTGGGG - Intronic
1108704675 13:52974430-52974452 GGTGACCTTCCCCCTGCCTGGGG - Intergenic
1121343192 14:93116778-93116800 TCTGACCAGGCCCCGACCTTGGG + Intergenic
1121719248 14:96097817-96097839 TCTGGCCTTCACCCCACATGGGG + Intergenic
1127208512 15:56746167-56746189 TCTGATCTTCACCCTAGCTGAGG - Intronic
1129915609 15:79267239-79267261 TATGTCCTACCCCAGACCTGTGG - Intergenic
1132406133 15:101542793-101542815 TTTGCCCTTTCCCCGGCCTGAGG + Intergenic
1133914424 16:10096259-10096281 TCTGACATTCTCTGGACCTGTGG + Intronic
1135288467 16:21214221-21214243 TCTCACCTAACCCAGACCTGTGG + Exonic
1135378263 16:21969827-21969849 TCTCATCTTCCCCCTGCCTGTGG + Intronic
1141379812 16:83566322-83566344 TCTGCCCTTTCCCCAACATGGGG + Intronic
1145217870 17:21065844-21065866 AATGACCGCCCCCCGACCTGTGG - Intergenic
1145391030 17:22455448-22455470 CCTGCCCTTCCCCCGGCCTCAGG - Intergenic
1149577951 17:57727309-57727331 TGTGACTTTCCCAGGACCTGCGG - Intergenic
1151344952 17:73495745-73495767 GCTGTCCTTCTCCCGACCTGAGG - Intronic
1151684915 17:75640671-75640693 TCTGACCTCCACCAAACCTGTGG + Intronic
1155003741 18:21709590-21709612 TCTCACCTTCCTCCCAGCTGTGG + Intronic
1155092436 18:22524852-22524874 GATGACCTTCCCCCCACCAGAGG + Intergenic
1162391215 19:10391285-10391307 TCTGCCCTTCCCCGGACCCCCGG + Exonic
1163178790 19:15584249-15584271 TCAGACCTTGCCTCCACCTGTGG - Intergenic
1166409542 19:42547414-42547436 TCTGACCCTCCCCTCACCAGGGG - Intronic
1167263733 19:48473121-48473143 TCTGAGCATCCCCCACCCTGGGG + Intronic
925027503 2:621272-621294 TCTGAGCCTCCTCCGCCCTGGGG + Intergenic
925997987 2:9307368-9307390 TCTGACCTCCACAGGACCTGGGG - Intronic
929024558 2:37587237-37587259 TCTGCCCTGCCCCCGACCCCAGG - Intergenic
932322670 2:70833575-70833597 TCTTACCTGTCCCAGACCTGAGG - Intronic
933790632 2:85881196-85881218 TGAGACCTTCCCCAGACATGTGG + Intronic
936013447 2:108940543-108940565 TCTCACCTCCGCCCGATCTGGGG - Intronic
936471885 2:112805995-112806017 GCTGCCCTTCCCCGGAGCTGTGG + Intergenic
937541465 2:122959920-122959942 TCTCTCATTCCCCCGACCTCTGG - Intergenic
937985905 2:127637992-127638014 TCTGTCCTTCTCCCCACCCGGGG + Intergenic
946193866 2:218021952-218021974 TCTGCCCTTCCCCCGCTCTGAGG - Intergenic
947481460 2:230504227-230504249 TCTGAACTTCCTGTGACCTGTGG + Exonic
1168898065 20:1337645-1337667 TCTGTTCTTCCCATGACCTGAGG + Intronic
1173409879 20:42800890-42800912 TCTACCCTTCCCCTCACCTGAGG + Intronic
1174295697 20:49543579-49543601 TCTGAGCTTCCTCCCACCTCTGG + Intronic
1181568271 22:23752520-23752542 CCTGACCTTCCTGTGACCTGAGG - Intergenic
1182440676 22:30362173-30362195 TCTGAGCTTCCCAGCACCTGTGG + Intronic
1183547137 22:38460314-38460336 CCTGCCCTTCCACAGACCTGTGG - Intergenic
1183646026 22:39127246-39127268 TCTGACCCTTCCCCCACCCGTGG + Intronic
1183674338 22:39291302-39291324 TCTGACCTTCCCCAGCCTTGAGG + Intergenic
1184257805 22:43296968-43296990 TCTGACCTCCCCCAGCTCTGCGG - Intronic
1185275554 22:49948948-49948970 TCTGGCCTGCCCCAGGCCTGAGG - Intergenic
951758200 3:26116159-26116181 TTTTACCTTCCCCCAACCTCTGG + Intergenic
953885291 3:46711580-46711602 CCTGCCCTTCCCCTGACATGGGG + Intergenic
954654153 3:52183860-52183882 ACTGACCTTCCCCCAAGCTCTGG + Intergenic
956885171 3:73551916-73551938 ACTGACCTTCTCCAGACCTCAGG - Intronic
960006086 3:112782659-112782681 TCTGACCTTCCCCCGCCCTCTGG + Intronic
960414484 3:117367678-117367700 CCTGCCCTTTCCCCAACCTGAGG - Intergenic
961637770 3:128343803-128343825 TATGTCCTTCCACCAACCTGGGG + Intronic
962460794 3:135610807-135610829 CCTGAGCTTCCCCAGCCCTGTGG + Intergenic
962666044 3:137654485-137654507 TCTGATCTCCACTCGACCTGGGG + Intergenic
963343266 3:144063424-144063446 TCTGACTTTGCCCCAACCTTAGG + Intergenic
965263311 3:166510700-166510722 ACTGCCCTTCCCCCTACCCGGGG - Intergenic
967752889 3:193134599-193134621 TATTACCTTCACCCGACCTCAGG - Intergenic
967893638 3:194380823-194380845 TCAGACAGTCCCCAGACCTGAGG - Intergenic
969292579 4:6249693-6249715 GCTGACCTTCCTGCAACCTGTGG - Intergenic
969313546 4:6368244-6368266 GCTTACCCTCCACCGACCTGAGG + Intronic
969594801 4:8142887-8142909 TCCCACCTTCCCCAGACCTGAGG - Intronic
970489927 4:16561929-16561951 TCTGACCTTTCACAAACCTGAGG + Intronic
972577021 4:40361303-40361325 TCAGACCCTCTCCAGACCTGGGG + Intergenic
975105494 4:70564145-70564167 TCTGACCCACCCCCTACCTGGGG - Intergenic
975683170 4:76896542-76896564 CCTGAGCTTCCCCCTATCTGGGG + Exonic
981930101 4:150180694-150180716 TCTGACCTTCTCCTGCCCTCTGG + Intronic
982060765 4:151602086-151602108 TGTGTCCTTCCCACGACATGTGG + Intronic
983536513 4:168863001-168863023 TCTGCCCTTCACCAGAGCTGGGG + Intronic
988962185 5:36381280-36381302 TCAGACCTTCCCCAGACCTGTGG + Intergenic
998127668 5:139635433-139635455 TCTGTCCTTCCCCTTACCTTGGG + Intergenic
1001236320 5:170032496-170032518 TCTGAGCTTGGCCAGACCTGAGG - Intronic
1001778941 5:174350996-174351018 TCTGACCTTCCCCACACCGCAGG + Intergenic
1002659686 5:180783397-180783419 TCTGACCTTCCACTGCCCTGAGG + Intergenic
1003103591 6:3196096-3196118 TCTGCCCTTCCCCATCCCTGGGG - Intergenic
1006803974 6:36776838-36776860 ACTGACCTTCCTCCTAACTGGGG + Intronic
1008471326 6:51888576-51888598 TCTTATCTTCACCTGACCTGTGG - Intronic
1016152198 6:140755308-140755330 GCTGACCTTTTCCTGACCTGAGG + Intergenic
1019078698 6:169412496-169412518 TCTCCTCTTCCCCCCACCTGGGG + Intergenic
1022511342 7:30936787-30936809 TCTGTCCCTACCCAGACCTGGGG + Intergenic
1023273521 7:38493211-38493233 TCAGACCTTCCCCTGAGCTCTGG + Intronic
1026020381 7:66700714-66700736 TCTGACCTCCCACCTGCCTGGGG + Intronic
1026879910 7:73901646-73901668 TCTGACCTCCCACCTGCCTGGGG - Intergenic
1027266637 7:76498379-76498401 CCTGCCCTTCCCCTGCCCTGGGG + Intronic
1027318018 7:76996497-76996519 CCTGCCCTTCCCCTGCCCTGGGG + Intergenic
1029302808 7:99598376-99598398 TCTACCCTTCCCTCCACCTGCGG - Intronic
1029630111 7:101744717-101744739 TGTGACCTCCCCCCGTCCCGTGG - Intergenic
1035412745 7:158658194-158658216 TCTGCCCTTCCCTCTCCCTGTGG - Intronic
1048274040 8:133052507-133052529 GCAGACCTTCCCCAAACCTGTGG + Intronic
1049342906 8:142123311-142123333 CCTCACCTTCCCCCAAGCTGGGG - Intergenic
1049404720 8:142447311-142447333 CCTGACCTTCTCCCTCCCTGGGG + Intergenic
1051745120 9:20288241-20288263 TCTGACCTTCCCTGGCCTTGAGG - Intergenic
1056112373 9:83408522-83408544 TCTGAACTTTCCCCCACCTGGGG - Intronic
1057938399 9:99259420-99259442 TCTTACGGTCCCCAGACCTGCGG - Intergenic
1059800797 9:117747715-117747737 TTTGATCTTCCCAGGACCTGTGG + Intergenic
1061754709 9:132804424-132804446 TCTGACCTCCCCCCAGCCTTTGG - Intronic
1061923700 9:133795786-133795808 TCTGCCCTGGCCCCTACCTGGGG + Intronic
1061956283 9:133962885-133962907 TCTGACCTTCCTCCCTCCTGAGG + Intronic
1187758140 X:22548317-22548339 ACTGACCTTCCCCCTTGCTGGGG + Intergenic
1189802221 X:44701912-44701934 TCTGACCAACTCCCGACCTCAGG - Intergenic
1190266790 X:48831662-48831684 TCTCCCCTTCCCAGGACCTGGGG + Intronic
1194080960 X:89465029-89465051 TCAGACCTTGCCCCAAGCTGTGG - Intergenic
1195195078 X:102489589-102489611 TCTGAGCTCCCCCAGACATGTGG - Intergenic
1197705560 X:129632167-129632189 TCTGTCCTTTCCACCACCTGAGG + Intergenic
1200433635 Y:3121234-3121256 TCAGACCTTGCCCCAAGCTGTGG - Intergenic