ID: 905804166

View in Genome Browser
Species Human (GRCh38)
Location 1:40863857-40863879
Sequence CCCCCGACCTGTGGCATCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 114}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905804158_905804166 18 Left 905804158 1:40863816-40863838 CCCTCCACGCATTTGACACTCTC 0: 1
1: 0
2: 0
3: 7
4: 104
Right 905804166 1:40863857-40863879 CCCCCGACCTGTGGCATCCTTGG 0: 1
1: 0
2: 1
3: 5
4: 114
905804157_905804166 23 Left 905804157 1:40863811-40863833 CCTTACCCTCCACGCATTTGACA 0: 1
1: 0
2: 1
3: 6
4: 105
Right 905804166 1:40863857-40863879 CCCCCGACCTGTGGCATCCTTGG 0: 1
1: 0
2: 1
3: 5
4: 114
905804159_905804166 17 Left 905804159 1:40863817-40863839 CCTCCACGCATTTGACACTCTCT 0: 1
1: 0
2: 0
3: 3
4: 96
Right 905804166 1:40863857-40863879 CCCCCGACCTGTGGCATCCTTGG 0: 1
1: 0
2: 1
3: 5
4: 114
905804160_905804166 14 Left 905804160 1:40863820-40863842 CCACGCATTTGACACTCTCTCTC 0: 1
1: 0
2: 1
3: 12
4: 154
Right 905804166 1:40863857-40863879 CCCCCGACCTGTGGCATCCTTGG 0: 1
1: 0
2: 1
3: 5
4: 114
905804162_905804166 -9 Left 905804162 1:40863843-40863865 CCTTCTCTGACCTTCCCCCGACC 0: 1
1: 0
2: 1
3: 33
4: 491
Right 905804166 1:40863857-40863879 CCCCCGACCTGTGGCATCCTTGG 0: 1
1: 0
2: 1
3: 5
4: 114
905804161_905804166 -8 Left 905804161 1:40863842-40863864 CCCTTCTCTGACCTTCCCCCGAC 0: 1
1: 0
2: 1
3: 22
4: 314
Right 905804166 1:40863857-40863879 CCCCCGACCTGTGGCATCCTTGG 0: 1
1: 0
2: 1
3: 5
4: 114
905804156_905804166 29 Left 905804156 1:40863805-40863827 CCAGAACCTTACCCTCCACGCAT 0: 1
1: 0
2: 0
3: 3
4: 98
Right 905804166 1:40863857-40863879 CCCCCGACCTGTGGCATCCTTGG 0: 1
1: 0
2: 1
3: 5
4: 114
905804155_905804166 30 Left 905804155 1:40863804-40863826 CCCAGAACCTTACCCTCCACGCA 0: 1
1: 0
2: 0
3: 6
4: 92
Right 905804166 1:40863857-40863879 CCCCCGACCTGTGGCATCCTTGG 0: 1
1: 0
2: 1
3: 5
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905804166 Original CRISPR CCCCCGACCTGTGGCATCCT TGG Intergenic
900279709 1:1858751-1858773 CCCTCGAGCTGTGGCTCCCTTGG - Intronic
902667875 1:17952298-17952320 GCCCAGACCTGTGGGCTCCTAGG - Intergenic
903536787 1:24072132-24072154 CCCCCGACCTTGGGGTTCCTTGG + Intronic
904744250 1:32701720-32701742 CCCCTGACCTCGGGCTTCCTTGG + Intronic
905804166 1:40863857-40863879 CCCCCGACCTGTGGCATCCTTGG + Intergenic
907764601 1:57396434-57396456 TCCCCCAAATGTGGCATCCTGGG - Intronic
908847842 1:68342967-68342989 TCCCCGGCCTGTCGCATCTTGGG - Intergenic
912527187 1:110292101-110292123 TCCTCTCCCTGTGGCATCCTGGG + Intergenic
912690418 1:111800781-111800803 GCCCTGACCTGGGGCATCCCTGG + Intronic
922211162 1:223487770-223487792 CCCCCGCCCTGTGGTTTCCCAGG - Intergenic
923054716 1:230417356-230417378 CCCCCTCCCTGTGGGATCCAGGG + Intronic
923467574 1:234262954-234262976 GCCCAGAACTGTGGCAACCTGGG - Intronic
1070333463 10:75433966-75433988 CCCCAGGCATGTGGCATCATAGG - Intronic
1072679606 10:97497834-97497856 CTCCCGTCGCGTGGCATCCTGGG - Intronic
1072793655 10:98337723-98337745 CCCCCTACCTGGGGCAGCCAAGG - Intergenic
1073146714 10:101286002-101286024 CCTCCTGCCTGTGGCCTCCTAGG + Intergenic
1076674062 10:132138747-132138769 CCCACGACCTGTGGGATGCACGG + Intronic
1078667616 11:13339616-13339638 CCAGCGACCTGGGGCATGCTAGG - Intronic
1078909596 11:15718625-15718647 CCCCAGAGCTGGGGCATCATGGG - Intergenic
1079112396 11:17612255-17612277 CCCCCTCGCTGTGGGATCCTGGG + Exonic
1080471496 11:32550305-32550327 CCCCCGATCTGTGGCCTGTTAGG + Intergenic
1083154981 11:60817093-60817115 TCTCCTACCTGTGCCATCCTAGG - Intergenic
1083474251 11:62905822-62905844 CCCCAGGCCTTTGGAATCCTTGG - Intergenic
1085056461 11:73406993-73407015 ACCCAGACCTCTGGCTTCCTTGG - Intronic
1088369873 11:109077356-109077378 CCCACGACATCAGGCATCCTGGG + Intergenic
1089505296 11:118958310-118958332 CCCCAGGCCTGTGGCTCCCTTGG + Exonic
1090264059 11:125343035-125343057 CCCCCAGCCTGTGGCCCCCTTGG - Intronic
1092048734 12:5452737-5452759 CCCCCCACCTAGGGCAGCCTTGG + Intronic
1096598900 12:52715536-52715558 CCCCAGGCCTCTGGCCTCCTGGG + Intergenic
1096627211 12:52903447-52903469 CCCCCGACCACTGGGTTCCTGGG + Intronic
1101578339 12:106018735-106018757 CCTCTGCCCTGTGGCATCCAGGG - Intergenic
1103735199 12:123056707-123056729 CCCCTGGCCTGGGGCATCCCGGG - Intronic
1103935569 12:124474803-124474825 CCCCCGCCCTGTGCCATCCTTGG + Intronic
1113512547 13:110867621-110867643 CTCCCGGCCTGTGGCTTCCAGGG - Intergenic
1114364739 14:22013995-22014017 CCCCCTACCTGGGGCATCTAAGG - Intergenic
1118014073 14:61640629-61640651 CCTCCCACCTGTGTCAGCCTGGG + Intronic
1118600008 14:67465363-67465385 CCCCAGCCCTGTGCCATCCAGGG - Intronic
1118990455 14:70792722-70792744 TGCCAGACCTGTGGCACCCTGGG - Intronic
1121419897 14:93805900-93805922 CTCCCGTCCTGTTCCATCCTGGG + Intergenic
1121921789 14:97888608-97888630 ACCCCAACCTGTGGCCTCCCAGG - Intergenic
1122355807 14:101122268-101122290 CCCCCGATGTGTGGCCTCCTGGG + Intergenic
1122544112 14:102512915-102512937 CCCTCCACCTGGGGCTTCCTAGG - Intergenic
1128815233 15:70603305-70603327 GCCCCGACCTGCGGCAATCTTGG + Intergenic
1129133749 15:73527188-73527210 TCCCAGACCTGTGGAATTCTAGG + Intronic
1132405301 15:101538384-101538406 CCCCCAACCTGGGGTTTCCTGGG - Intergenic
1138904158 16:61310196-61310218 CCTCTGACCTGTGGCTTCTTAGG + Intergenic
1139960039 16:70712226-70712248 CCCCAGACATGAGGCGTCCTTGG + Intronic
1140149582 16:72348647-72348669 CCCCCAACCCCTGGCATCCGTGG - Intergenic
1150373422 17:64661620-64661642 CCCCCGCCCCGAGTCATCCTCGG + Intronic
1150778793 17:68102146-68102168 CCCCCGCCCCGAGTCATCCTCGG - Intergenic
1151225583 17:72645660-72645682 CCCCAGACCTCTGGCTTTCTTGG + Intergenic
1152580853 17:81165099-81165121 CCCCTGCCCTGTGCCATCCATGG - Intronic
1155089676 18:22494296-22494318 CCCAAGAGCTGTGGCTTCCTGGG + Intergenic
1166499590 19:43330937-43330959 GCCCCCACCTGTGGCATGGTCGG + Intergenic
1166747110 19:45146652-45146674 GCCCCCACCCCTGGCATCCTGGG - Exonic
927025716 2:19067141-19067163 CCCCCTTCCTGTTCCATCCTAGG + Intergenic
927427582 2:22997786-22997808 CTCCCCACATGTGGTATCCTTGG - Intergenic
927918539 2:26952588-26952610 TCCCCACCCTGTGGCATCCCCGG - Intergenic
930745974 2:54884104-54884126 CCCTCAACCTGTGGCATCTGAGG - Intronic
933215938 2:79629997-79630019 CCCCTGCCCTGTATCATCCTAGG + Intronic
934520647 2:95018165-95018187 CCCCAGAAATGTGGCATCCGAGG + Intergenic
947988702 2:234470310-234470332 CCGCCTGCCTGTGGCCTCCTAGG + Intergenic
948534777 2:238637733-238637755 CCCCAGTCCAGTGGCAGCCTGGG + Intergenic
948759228 2:240180164-240180186 CCCCTGCCCTGTGGTATCCCAGG + Intergenic
1170683221 20:18545229-18545251 CCCCCTAACTGTGGACTCCTTGG - Intronic
1172424350 20:34845218-34845240 CCCCTGATCTGGGGCATCCCTGG + Exonic
1172844016 20:37919068-37919090 GGCCTGATCTGTGGCATCCTGGG + Intronic
1175890448 20:62313619-62313641 CGCCCGGCCTGGGGCAGCCTGGG - Intronic
1178406265 21:32325704-32325726 CCCCAGGCCTCTGGCATGCTGGG - Intronic
1179043939 21:37829025-37829047 CCCAGGGCCTGTGCCATCCTGGG + Intronic
1179982985 21:44906031-44906053 CCACCGACCTGTGACCTCCCAGG - Intronic
1180839082 22:18950382-18950404 CCCCCAACCTCTGACCTCCTAGG + Intergenic
1181062810 22:20290104-20290126 CCCCCAACCTCTGACCTCCTAGG - Intergenic
1181127876 22:20712459-20712481 CCCCCGGCCTGTGGCCACCCTGG + Intronic
1183391330 22:37546996-37547018 GCCCCGCCCTGTGGCTGCCTGGG + Intergenic
951520732 3:23608952-23608974 CGCCTGCCCTGTGGCAACCTGGG + Intergenic
955675307 3:61442138-61442160 CCCCACACCTGTGGCATTGTTGG - Intergenic
957450584 3:80377071-80377093 CCTCCGCCTTCTGGCATCCTGGG + Intergenic
960528460 3:118736940-118736962 TCCCACACCTGTGGCATCATGGG - Intergenic
963778650 3:149465122-149465144 GCCCCGCCCTGCGGCATCCCAGG + Intergenic
968659306 4:1792671-1792693 CCCCAGGCCTGTGTCCTCCTTGG + Intergenic
969290080 4:6233276-6233298 CCCCAGGCCTGTGGCCACCTCGG + Intergenic
969291026 4:6240131-6240153 CCTCTGACCTTTGGCATCCTAGG - Intergenic
969342247 4:6549514-6549536 CCCCTCACCTGTGCCTTCCTGGG + Intronic
985133968 4:186766752-186766774 TCCCTGACCTGTGGAATCTTAGG - Intergenic
991995148 5:72379423-72379445 CCCCCATCCTGAGGCAACCTAGG - Intergenic
995526523 5:113054786-113054808 CCCCAGGCCTGTGGCAGCCCAGG + Intronic
995530908 5:113091160-113091182 CCCCAGACCAGTGGCACCTTTGG + Intronic
997409588 5:133680944-133680966 ACCCAGACCTGTGGGATTCTGGG + Intergenic
997461442 5:134055189-134055211 CCCCACCCCTGTGGCTTCCTGGG - Intergenic
1001906663 5:175478791-175478813 CCCCCGGCCCGAGGCATCCCCGG - Intronic
1002637662 5:180616168-180616190 CCCCCCACCTTAGGCATCTTGGG - Intronic
1003891112 6:10564535-10564557 CCCCCGACATCTGTCAACCTTGG + Intronic
1006223791 6:32519115-32519137 ACCCTGACCTGTGACATCATGGG + Intronic
1006330928 6:33390518-33390540 CCCCCAACCTTTGATATCCTGGG - Intergenic
1006517329 6:34552233-34552255 CCCCTGTCCTGTGGCAAGCTGGG - Intronic
1018714922 6:166524821-166524843 CCCACGAGCTGTGTCATCTTGGG - Intronic
1019530678 7:1501751-1501773 TCCCCCAGCTGTGCCATCCTGGG + Intronic
1020210322 7:6153998-6154020 CCCCTGACCTGTGTGATCCCGGG + Exonic
1023493065 7:40764865-40764887 GCCCCAACCTGTGGCATGCTTGG - Intronic
1023580727 7:41680059-41680081 CCCCCGCTCTGTCGCATCATAGG + Intergenic
1023978389 7:45050985-45051007 TCACCGAGCTGTGGCATTCTAGG - Intronic
1034331486 7:150287010-150287032 CACCCGGCTTGTGGCATGCTGGG - Intronic
1034378473 7:150667377-150667399 CCCCAGACCAGTGGCATCATGGG + Intergenic
1034519484 7:151608282-151608304 CCACCAAGTTGTGGCATCCTGGG + Intronic
1035162322 7:156960411-156960433 CCCATGTCCTGTGGCCTCCTCGG - Intronic
1035264774 7:157684837-157684859 GCCCCGCCCTGTGCCCTCCTGGG + Intronic
1045111882 8:98944427-98944449 CTCCCGGCCTGGGGCAGCCTGGG + Exonic
1050260659 9:3837749-3837771 CCCCCAACCTGTGGAAACCACGG - Intronic
1056655411 9:88504762-88504784 CGCCTGTCCTGTGTCATCCTGGG + Intergenic
1059529589 9:115023609-115023631 CCCCTGGCCTGGGGCATCTTTGG - Intronic
1060484397 9:124037965-124037987 CCCCTGAACTGTGTGATCCTGGG - Intergenic
1060794497 9:126504799-126504821 ACCCCCACCAGGGGCATCCTCGG - Exonic
1061608199 9:131727545-131727567 GCCTGGACCTGTGGCATCTTTGG - Intronic
1062038048 9:134391464-134391486 CCCCCAGCCTGTGGGCTCCTGGG - Intronic
1185747889 X:2586062-2586084 CCTCCCACCTGTGTCATCCTGGG - Intergenic
1189730446 X:44014807-44014829 CACCAGTTCTGTGGCATCCTGGG + Intergenic
1190280667 X:48927355-48927377 CCCTCAACCTGTGGGATCCCAGG - Intronic
1197173165 X:123456704-123456726 CTCCAGAGCTGTGGCATCATTGG + Intronic
1198940955 X:141954535-141954557 GCCCCTACCTGGGCCATCCTAGG + Intergenic
1200127148 X:153821116-153821138 GCCCCCAACTGTGGCCTCCTGGG + Intronic