ID: 905804168

View in Genome Browser
Species Human (GRCh38)
Location 1:40863858-40863880
Sequence CCCCGACCTGTGGCATCCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 86}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905804162_905804168 -8 Left 905804162 1:40863843-40863865 CCTTCTCTGACCTTCCCCCGACC 0: 1
1: 0
2: 1
3: 33
4: 491
Right 905804168 1:40863858-40863880 CCCCGACCTGTGGCATCCTTGGG 0: 1
1: 0
2: 2
3: 8
4: 86
905804160_905804168 15 Left 905804160 1:40863820-40863842 CCACGCATTTGACACTCTCTCTC 0: 1
1: 0
2: 1
3: 12
4: 154
Right 905804168 1:40863858-40863880 CCCCGACCTGTGGCATCCTTGGG 0: 1
1: 0
2: 2
3: 8
4: 86
905804158_905804168 19 Left 905804158 1:40863816-40863838 CCCTCCACGCATTTGACACTCTC 0: 1
1: 0
2: 0
3: 7
4: 104
Right 905804168 1:40863858-40863880 CCCCGACCTGTGGCATCCTTGGG 0: 1
1: 0
2: 2
3: 8
4: 86
905804161_905804168 -7 Left 905804161 1:40863842-40863864 CCCTTCTCTGACCTTCCCCCGAC 0: 1
1: 0
2: 1
3: 22
4: 314
Right 905804168 1:40863858-40863880 CCCCGACCTGTGGCATCCTTGGG 0: 1
1: 0
2: 2
3: 8
4: 86
905804159_905804168 18 Left 905804159 1:40863817-40863839 CCTCCACGCATTTGACACTCTCT 0: 1
1: 0
2: 0
3: 3
4: 96
Right 905804168 1:40863858-40863880 CCCCGACCTGTGGCATCCTTGGG 0: 1
1: 0
2: 2
3: 8
4: 86
905804156_905804168 30 Left 905804156 1:40863805-40863827 CCAGAACCTTACCCTCCACGCAT 0: 1
1: 0
2: 0
3: 3
4: 98
Right 905804168 1:40863858-40863880 CCCCGACCTGTGGCATCCTTGGG 0: 1
1: 0
2: 2
3: 8
4: 86
905804157_905804168 24 Left 905804157 1:40863811-40863833 CCTTACCCTCCACGCATTTGACA 0: 1
1: 0
2: 1
3: 6
4: 105
Right 905804168 1:40863858-40863880 CCCCGACCTGTGGCATCCTTGGG 0: 1
1: 0
2: 2
3: 8
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905804168 Original CRISPR CCCCGACCTGTGGCATCCTT GGG Intergenic
900241752 1:1620633-1620655 CCCCGGCCTGTGCCATTCTGTGG + Intronic
902200136 1:14827123-14827145 CCCAGTCCTGAGGCATCCATTGG + Intronic
902963077 1:19978377-19978399 CACCGATCCGTTGCATCCTTGGG + Exonic
904744252 1:32701721-32701743 CCCTGACCTCGGGCTTCCTTGGG + Intronic
905804168 1:40863858-40863880 CCCCGACCTGTGGCATCCTTGGG + Intergenic
915891146 1:159774962-159774984 CCCCGACCTGTGAGATCCTCAGG - Intergenic
917793683 1:178516295-178516317 CAACCACCTGTAGCATCCTTAGG + Intronic
920352083 1:205343982-205344004 CCCCGGCCTGCGGCTTGCTTCGG - Intronic
1063088096 10:2837363-2837385 CGCTGGCCTGTGGGATCCTTTGG - Intergenic
1065554945 10:26905825-26905847 CCCCGAGCTGTGGGCTCCTGTGG + Intergenic
1067168318 10:43883074-43883096 CCTCGAACTGTGTCAACCTTGGG + Intergenic
1068008838 10:51422326-51422348 CACCTAGCTGTGGCATCCTATGG - Intronic
1069703152 10:70440802-70440824 TCGCGAACTGTGGCAGCCTTGGG - Intronic
1077343605 11:2036701-2036723 CCCAGACTTGGGGCTTCCTTTGG + Intergenic
1080902494 11:36509729-36509751 CCCCGACCTGTGGGAAGCGTGGG + Intronic
1081155263 11:39682072-39682094 CCCTGACCTGTGGAATCTTTTGG + Intergenic
1089638935 11:119834178-119834200 GCCCCACCTGGGCCATCCTTAGG - Intergenic
1202826591 11_KI270721v1_random:91890-91912 CCCAGACTTGGGGCTTCCTTTGG + Intergenic
1092048736 12:5452738-5452760 CCCCCACCTAGGGCAGCCTTGGG + Intronic
1100853660 12:98739406-98739428 CCCCCACCTGTCCCATCCATTGG - Intronic
1103935571 12:124474804-124474826 CCCCGCCCTGTGCCATCCTTGGG + Intronic
1117899200 14:60515334-60515356 CCCAGATCTGTGGCCTCCGTGGG - Intronic
1118715388 14:68556254-68556276 CCCAGACCAGAGCCATCCTTGGG + Intronic
1121257920 14:92544654-92544676 CCTCGACTTGTGGCATGCTCTGG + Intronic
1122355809 14:101122269-101122291 CCCCGATGTGTGGCCTCCTGGGG + Intergenic
1126892284 15:53219241-53219263 CCCCAACCTCTGGCATGCCTAGG - Intergenic
1128533405 15:68470741-68470763 CCCCGACCTTAGGCCTCCTCTGG - Intergenic
1130574718 15:85081652-85081674 CCATGCCCTGTGGGATCCTTGGG + Intronic
1131225322 15:90620117-90620139 CCCCGAGCTGTGGCAGGCTGTGG + Intronic
1132738009 16:1397049-1397071 TCCCGACCTGTGCCAGCCCTCGG + Intronic
1134221756 16:12360505-12360527 CCACCACCTGTGACATCGTTGGG - Intronic
1139471341 16:67179621-67179643 CGCTGCCCTGTGGCATCATTGGG - Intronic
1139529931 16:67537970-67537992 CCCCGCCCCGTGACCTCCTTGGG + Intronic
1140098664 16:71895885-71895907 CCCCGAGGTGTGTCTTCCTTGGG + Intronic
1140743576 16:77962386-77962408 CCCCTACCTATGGCTCCCTTTGG - Intronic
1141087798 16:81109096-81109118 CCCCGCCCCGTGCCATCCCTTGG - Intergenic
1142110826 16:88330216-88330238 ACGGGACCTGTGGCATCCTGTGG + Intergenic
1142150195 16:88509304-88509326 CCCCGCCCTGTGGCTCCCATAGG - Intronic
1142260248 16:89039509-89039531 CCCTGCCCCGTGGCCTCCTTGGG + Intergenic
1143705634 17:8696125-8696147 CCCCAACCTGGGGCATTCTCCGG - Intergenic
1146659456 17:34654680-34654702 CCCCGACCACTGGCTTACTTTGG + Intergenic
1147681584 17:42251145-42251167 CCCCCAAATATGGCATCCTTTGG - Intronic
1148475785 17:47927859-47927881 CCCCCACCTGTGTCCTCCCTGGG + Exonic
1151816416 17:76473585-76473607 CCCCGAGCTGCGGCTTCCTGTGG - Intronic
1153976477 18:10272430-10272452 CCCAGAGCTCTGGCATTCTTGGG + Intergenic
1154197835 18:12279331-12279353 CCCAGGCCGGTGGAATCCTTGGG - Intergenic
1158640362 18:59198218-59198240 TCCCTACCTGTGGCCTCATTTGG - Intergenic
1159334418 18:67044360-67044382 CCCAGGCCTGTGACACCCTTTGG + Intergenic
1163756553 19:19109912-19109934 CCCCGACCTGCGCCCTCCCTGGG - Intronic
1166200915 19:41237594-41237616 CCATGCACTGTGGCATCCTTTGG + Intronic
1167215571 19:48162244-48162266 CCCAGCCCTGTGACATACTTTGG + Exonic
1167448734 19:49554957-49554979 CCCCCACCTGTGGCAGCCTGAGG - Intergenic
931225381 2:60324815-60324837 CCCCACCCTGTGCCTTCCTTAGG + Intergenic
935112413 2:100105123-100105145 CCCGGCCCTGTCGCATCCCTCGG + Intronic
936679282 2:114752107-114752129 CCCTGACCATTGGCATCATTTGG - Intronic
940094074 2:149953602-149953624 CCCTGACCTCAGCCATCCTTGGG - Intergenic
946219349 2:218213216-218213238 CCCCCATCTGTGGAAGCCTTAGG - Intergenic
947550382 2:231041419-231041441 CCCCGACCTCCTGCATCCTGAGG + Intronic
948446611 2:238038356-238038378 CCCCGACCCCTGCCATCCGTCGG + Intronic
1170683219 20:18545228-18545250 CCCCTAACTGTGGACTCCTTGGG - Intronic
1172215782 20:33234678-33234700 CCCAGGCCTGAGGGATCCTTTGG - Intergenic
1172222412 20:33283064-33283086 CCCCGCCCGGAGGCAGCCTTGGG - Intronic
1172424352 20:34845219-34845241 CCCTGATCTGGGGCATCCCTGGG + Exonic
1174850078 20:53985386-53985408 CCCCGATGGGTTGCATCCTTTGG + Exonic
1175497031 20:59422410-59422432 CCCCAACCTGGGCCAGCCTTTGG + Intergenic
1175953091 20:62593820-62593842 CCCCAACCTGGGGCATCCTTTGG + Intergenic
952240618 3:31528434-31528456 CTCCGACCTGTGTCATTCCTGGG + Intergenic
962372971 3:134835871-134835893 CCCTGCCCTGTGGGGTCCTTTGG + Intronic
965788697 3:172364327-172364349 CCCAGACCTGTGGCTTCCATTGG + Intronic
968659308 4:1792672-1792694 CCCAGGCCTGTGTCCTCCTTGGG + Intergenic
969441203 4:7217805-7217827 CTCCGACCTGTGGGAGCCGTGGG + Intronic
995530910 5:113091161-113091183 CCCAGACCAGTGGCACCTTTGGG + Intronic
996818018 5:127595075-127595097 CTACGAGCTGTGGCTTCCTTGGG + Intergenic
997409590 5:133680945-133680967 CCCAGACCTGTGGGATTCTGGGG + Intergenic
1001672401 5:173484875-173484897 GACCGACCTGTGGCTCCCTTTGG - Intergenic
1006223793 6:32519116-32519138 CCCTGACCTGTGACATCATGGGG + Intronic
1019058352 6:169238779-169238801 CCCAGAGCTGTGTCATCCTCAGG - Intronic
1020084598 7:5303615-5303637 CCCTGACCTGTGGCATCGTGTGG - Exonic
1025209704 7:57013584-57013606 CCCCGACCTGTGGCATCACGTGG + Intergenic
1025662249 7:63563267-63563289 CCCCGACCTGTGGCATCACGTGG - Intergenic
1030359863 7:108583628-108583650 ACTCGACCAGAGGCATCCTTGGG - Intergenic
1034436038 7:151063174-151063196 CCCCCACCTGAGTCATCCTGCGG - Intronic
1035024815 7:155818586-155818608 CCCCTTCCTGTGGCATCCACTGG + Intergenic
1035424303 7:158757525-158757547 CCGCGAGCTCTGGGATCCTTTGG - Intronic
1035424313 7:158757567-158757589 CCGCGAGCTCTGGGATCCTTTGG - Intronic
1039595508 8:38787298-38787320 GCCCGTCCTGTGGCCTCCTCAGG - Exonic
1049456426 8:142693339-142693361 CCCAGAGGTGTGGGATCCTTTGG - Intergenic
1053279155 9:36806128-36806150 CCCGGCCCTGTGGCCTCCTGTGG - Intergenic
1060794495 9:126504798-126504820 CCCCCACCAGGGGCATCCTCGGG - Exonic
1061559993 9:131395688-131395710 CCAGCACCTGTGGCATCCATGGG - Intronic
1061608197 9:131727544-131727566 CCTGGACCTGTGGCATCTTTGGG - Intronic
1185747888 X:2586061-2586083 CTCCCACCTGTGTCATCCTGGGG - Intergenic
1185850484 X:3481323-3481345 TCCCAACCAGTGGCATCCTAAGG + Intergenic
1186654469 X:11598027-11598049 CCAAGACCTGTGGCAGTCTTAGG - Intronic
1192168727 X:68841594-68841616 TCCTTACCTTTGGCATCCTTTGG + Exonic
1198064388 X:133082037-133082059 CCCAGACCTGTGATATCCCTTGG + Intronic
1199627076 X:149750630-149750652 CCCCAACCTGGGGCTTCCCTGGG - Intergenic