ID: 905804172

View in Genome Browser
Species Human (GRCh38)
Location 1:40863867-40863889
Sequence GTGGCATCCTTGGGACTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 167}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905804160_905804172 24 Left 905804160 1:40863820-40863842 CCACGCATTTGACACTCTCTCTC 0: 1
1: 0
2: 1
3: 12
4: 154
Right 905804172 1:40863867-40863889 GTGGCATCCTTGGGACTTCCTGG 0: 1
1: 0
2: 0
3: 14
4: 167
905804164_905804172 -9 Left 905804164 1:40863853-40863875 CCTTCCCCCGACCTGTGGCATCC 0: 1
1: 0
2: 2
3: 28
4: 308
Right 905804172 1:40863867-40863889 GTGGCATCCTTGGGACTTCCTGG 0: 1
1: 0
2: 0
3: 14
4: 167
905804158_905804172 28 Left 905804158 1:40863816-40863838 CCCTCCACGCATTTGACACTCTC 0: 1
1: 0
2: 0
3: 7
4: 104
Right 905804172 1:40863867-40863889 GTGGCATCCTTGGGACTTCCTGG 0: 1
1: 0
2: 0
3: 14
4: 167
905804162_905804172 1 Left 905804162 1:40863843-40863865 CCTTCTCTGACCTTCCCCCGACC 0: 1
1: 0
2: 1
3: 33
4: 491
Right 905804172 1:40863867-40863889 GTGGCATCCTTGGGACTTCCTGG 0: 1
1: 0
2: 0
3: 14
4: 167
905804159_905804172 27 Left 905804159 1:40863817-40863839 CCTCCACGCATTTGACACTCTCT 0: 1
1: 0
2: 0
3: 3
4: 96
Right 905804172 1:40863867-40863889 GTGGCATCCTTGGGACTTCCTGG 0: 1
1: 0
2: 0
3: 14
4: 167
905804161_905804172 2 Left 905804161 1:40863842-40863864 CCCTTCTCTGACCTTCCCCCGAC 0: 1
1: 0
2: 1
3: 22
4: 314
Right 905804172 1:40863867-40863889 GTGGCATCCTTGGGACTTCCTGG 0: 1
1: 0
2: 0
3: 14
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905804172 Original CRISPR GTGGCATCCTTGGGACTTCC TGG Intergenic
901124365 1:6918708-6918730 CTGGGCTCCTTGGGACTTCCTGG + Intronic
902342622 1:15794035-15794057 GTAGCAGCATGGGGACTTCCAGG - Intergenic
902584135 1:17427731-17427753 GTGGCATCCTGGGCACTGCAGGG - Intronic
902873581 1:19328252-19328274 GTGGCGTCCTGGAGGCTTCCAGG - Intronic
903222765 1:21878204-21878226 GTGGCAGCATGGGGACCTCCGGG - Exonic
905804172 1:40863867-40863889 GTGGCATCCTTGGGACTTCCTGG + Intergenic
906236229 1:44212862-44212884 GTGGCCTCGTGGGGATTTCCTGG - Intergenic
907324658 1:53629158-53629180 GTTGCATCCTTGGCACATCACGG - Intronic
907468100 1:54652959-54652981 GTGTCATCTTTGGGTCTTCATGG - Exonic
908051487 1:60236453-60236475 GTAGATTCCTTAGGACTTCCTGG - Intergenic
909779003 1:79519332-79519354 GAAGCATCTTTGTGACTTCCTGG - Intergenic
910943177 1:92559002-92559024 TTAGTATCCTTGGGACATCCTGG - Intronic
912040612 1:105384938-105384960 ATGGCATTCTTGGGATTTCTTGG + Intergenic
912135207 1:106652651-106652673 TTGGTATCCTTGGGAAGTCCTGG - Intergenic
912579437 1:110706660-110706682 CTGGCATTCTTGGGAATGCCAGG - Intergenic
915141869 1:153773013-153773035 GTGGCATTCTTTCGACTTCGAGG - Exonic
915583700 1:156831647-156831669 TTGGCATCCTTGAGACCACCAGG - Intronic
917384730 1:174459442-174459464 TTGGTATCCTTGGGGCATCCCGG - Intronic
922787547 1:228290466-228290488 GGAGCATCCTTGGGGCTTCAGGG - Intronic
923604650 1:235432339-235432361 GTGGCCTCTGTGGCACTTCCTGG - Intronic
1062989226 10:1800050-1800072 GTGGCTTCCAGGGCACTTCCAGG + Intergenic
1063366538 10:5494194-5494216 CTGGCATCCTGGGCAATTCCTGG + Intergenic
1065442464 10:25766868-25766890 ATGGCATCCTGGGGGCTTCTGGG - Intergenic
1067221413 10:44346834-44346856 GAGGCATCCTTGGGATTTCATGG + Intergenic
1070672859 10:78390184-78390206 GCGGCATCACAGGGACTTCCTGG + Intergenic
1070790709 10:79187687-79187709 CTGGCATGCTTGGGACCCCCAGG + Intronic
1072724849 10:97806332-97806354 GTCCCTTCCCTGGGACTTCCAGG + Intergenic
1072798354 10:98374083-98374105 CTGGGTTCCTTGGGACTTCAGGG - Intergenic
1072800803 10:98391058-98391080 GTGGCTTCCTGAGGAGTTCCTGG - Exonic
1073237778 10:102033250-102033272 GTGGCATCTGTGGAATTTCCTGG - Intronic
1073754102 10:106562446-106562468 GTGGCATCATTGGGCCGTCAAGG + Intergenic
1074449571 10:113548266-113548288 GGGGCATCCTAGTGCCTTCCAGG + Intergenic
1076250828 10:128982690-128982712 GTGGCCTCCATGGGGCTGCCGGG - Intergenic
1076603563 10:131674967-131674989 GTGGCAGTTTTGGGGCTTCCAGG - Intergenic
1078941669 11:16013415-16013437 GTAACATCATTTGGACTTCCTGG + Intronic
1080205388 11:29723387-29723409 GAGTCATTCTTTGGACTTCCAGG + Intergenic
1081751585 11:45514894-45514916 GTGGCATCCCTGGAAAGTCCAGG - Intergenic
1083727239 11:64634959-64634981 AGGGCCTCTTTGGGACTTCCAGG - Intronic
1084893969 11:72251775-72251797 GTGGTATCCTGGGGATTCCCAGG + Intergenic
1085518968 11:77127155-77127177 ACGGCATCCTGGGGTCTTCCTGG + Intergenic
1086143044 11:83520046-83520068 GTGGCTTCTTAGGGCCTTCCAGG + Intronic
1088837985 11:113594795-113594817 TTGGTATCCTTGGGAGGTCCTGG + Intergenic
1090400084 11:126443453-126443475 GTGGCATCCTGGGGACACTCAGG + Intronic
1095781551 12:46065699-46065721 ATGGCATCCATGTGACTTCTGGG + Intergenic
1096396291 12:51269374-51269396 GAGGCTTTCCTGGGACTTCCAGG - Intronic
1098203120 12:68078374-68078396 ATGGCTTCCTTGGGATCTCCAGG + Intergenic
1100432994 12:94547064-94547086 GTGGCATCATGGGGACTGTCTGG + Intergenic
1100573910 12:95871432-95871454 TTGGTATCCTTGGGAGGTCCTGG + Intronic
1103507851 12:121453667-121453689 CTGCCATCCTTGGCACTTCTTGG - Intronic
1103685383 12:122728387-122728409 CTGTCATCATTGTGACTTCCTGG - Exonic
1104798356 12:131535862-131535884 CTGGCATCCTTGGGGGCTCCTGG + Intergenic
1107236492 13:38176822-38176844 GTGGCTTCCTGGGGACTTTTGGG + Intergenic
1111635285 13:90895080-90895102 TTTGCATCCTTGGGACTTGAAGG + Intergenic
1113365165 13:109669086-109669108 GTGACATCCCTTGGACCTCCGGG - Intergenic
1114623477 14:24113789-24113811 GTGGCCTTCTTGGGCCCTCCTGG - Intronic
1120569937 14:86105233-86105255 GTGGCAACCTTGTGCTTTCCAGG - Intergenic
1123957615 15:25355193-25355215 GTAGAAAACTTGGGACTTCCTGG - Intronic
1126864213 15:52920058-52920080 GTGGCAGCCCAGGGTCTTCCTGG - Intergenic
1128075410 15:64822592-64822614 GGGGCCACCTTGGGGCTTCCTGG + Exonic
1128774837 15:70312371-70312393 GGTGCATACTTGGCACTTCCTGG - Intergenic
1129301433 15:74627897-74627919 GTGGCTGCCTTGTGACTTCCAGG + Intronic
1131354528 15:91733076-91733098 GCGGCATCCATGTGCCTTCCTGG + Intergenic
1132364484 15:101247247-101247269 GTCCCTGCCTTGGGACTTCCCGG + Intronic
1133887492 16:9844184-9844206 GTGGCATTCTTTGGTCTCCCTGG + Intronic
1137252317 16:46749221-46749243 GTGGCGTCCTTGGGACTTTAAGG - Intronic
1137257259 16:46786520-46786542 TTGGCATCCTTTGGGCTTCCTGG - Intronic
1138322200 16:56125210-56125232 GGGGAATCCCTGGGATTTCCAGG + Intergenic
1138530682 16:57632724-57632746 GTGGTATGCTTGGCAGTTCCAGG + Intronic
1138592886 16:58012102-58012124 GTGACATCCTATGGAATTCCTGG - Intronic
1142260254 16:89039518-89039540 GTGGCCTCCTTGGGTGTTCAGGG + Intergenic
1143711682 17:8740172-8740194 GTGGCATCCATGGGAGGCCCTGG + Intronic
1144136062 17:12296236-12296258 AAGCCAGCCTTGGGACTTCCAGG - Intergenic
1144829136 17:18121894-18121916 GTGACATCCTTGGGAGGTGCTGG - Exonic
1147987517 17:44315053-44315075 GGGACATCCTGGGGACGTCCTGG + Intronic
1148105796 17:45118213-45118235 CTGGCTTCCTGGGGCCTTCCTGG - Intronic
1150390114 17:64785074-64785096 GGGACATCATGGGGACTTCCTGG + Intergenic
1151496257 17:74459967-74459989 GTGGCACCCTTGGTCCCTCCTGG + Intergenic
1152466376 17:80468882-80468904 GTGGCATCCTTGGATCTGCAGGG - Exonic
1152492627 17:80647817-80647839 GTGGCGGCCGTGGGGCTTCCAGG + Intronic
1158483364 18:57842706-57842728 CTGTCATCCTTGGGGTTTCCTGG + Intergenic
1161399225 19:4060085-4060107 CTGGCCTCCGTGGGATTTCCGGG + Intronic
1161627165 19:5334047-5334069 GTGGCTGCCTTGGGAGCTCCAGG - Intronic
1162574279 19:11489808-11489830 GTGGTATCCTGGGCCCTTCCTGG + Intronic
1163432954 19:17279115-17279137 CTGGGTTCCTTGGGACCTCCGGG + Exonic
1164144560 19:22504170-22504192 GTGTCATCTTTGGGAGCTCCAGG + Intronic
1164779593 19:30881765-30881787 GTGGCCCCCATGTGACTTCCAGG - Intergenic
1166688148 19:44808341-44808363 GTGGCATTCCTGGGATTCCCTGG + Intergenic
926478749 2:13360181-13360203 GTGGAAAGCTTGGAACTTCCTGG - Intergenic
937427063 2:121808884-121808906 ATGGCATCCATGGGGCTTCTTGG + Intergenic
940168262 2:150799156-150799178 CTGGAATCCTTGGGACTGTCAGG - Intergenic
940738554 2:157480720-157480742 GTGGCACCTCTGGGCCTTCCTGG + Intronic
942369161 2:175262883-175262905 ATGGCAGTCTTGTGACTTCCAGG - Intergenic
944658309 2:201898840-201898862 GTCACATCCTGGGGACTTCAAGG - Intergenic
946395931 2:219443790-219443812 CTGGTATCCTTGGCACTTACTGG - Intronic
946460450 2:219863966-219863988 GTGGCACCCTTGAGACTGCCTGG + Intergenic
947738417 2:232472530-232472552 CTGGCATCCTCTGGGCTTCCTGG + Intergenic
948382104 2:237557958-237557980 CTGGCATCCTTGGTGCTTCTTGG + Intergenic
1169522177 20:6385970-6385992 ATGGCATCCTTGGAACTTCGTGG + Intergenic
1170052070 20:12156879-12156901 GTGGTATTCTTGGGACTTAATGG + Intergenic
1170871894 20:20213509-20213531 GTGTCCTCCCTGGGAATTCCTGG - Intronic
1171866416 20:30489561-30489583 GCGGCAACCTTGAGCCTTCCCGG + Intergenic
1173141114 20:40483884-40483906 GGGGCATATCTGGGACTTCCTGG - Intergenic
1174653870 20:52153222-52153244 GTGTCCTCATTGCGACTTCCTGG - Exonic
1174760285 20:53200351-53200373 CTGGCATCCTTGGTGTTTCCTGG - Intronic
1176103264 20:63374153-63374175 GTGGCTTCCCCGGGACGTCCCGG - Intronic
1179182278 21:39055641-39055663 CTGGCATCATAAGGACTTCCTGG + Intergenic
1180367619 22:11955267-11955289 GTGACATCCTTAGGAATCCCTGG - Intergenic
1183322018 22:37170619-37170641 GTGGCACCCTTGGGACTGAGAGG - Intronic
949706219 3:6820369-6820391 TTGGCTTCCATGGGACTGCCTGG + Intronic
950206221 3:11083303-11083325 GTGCCATCCCTGGGGCTTGCTGG - Intergenic
950872709 3:16243301-16243323 GTCGCATCCTTGGGCCTCCTTGG - Intergenic
952132743 3:30384009-30384031 ATGGCATCTCTGGAACTTCCTGG - Intergenic
953009004 3:39006354-39006376 TTGGTATCATTGGGACTTCTTGG - Intergenic
954029709 3:47810261-47810283 CAGGTTTCCTTGGGACTTCCAGG - Intronic
956235193 3:67061735-67061757 GTTTCATCCTTGGGAGTTTCTGG - Intergenic
961192698 3:124975435-124975457 GTGGGATGCTTTGGGCTTCCTGG - Intronic
961673219 3:128549593-128549615 GGGGAATCCTTGGCACTTCCTGG + Intergenic
962607421 3:137044384-137044406 CTGGAACCCTGGGGACTTCCTGG - Intergenic
963088916 3:141463823-141463845 GTGACATTTTTGGTACTTCCTGG - Intergenic
970250623 4:14111885-14111907 TTGGCATCCTGGGAACTTCTGGG + Intergenic
970400675 4:15714387-15714409 GTCTCACCCTTGGGAATTCCTGG + Intronic
971765370 4:30823978-30824000 GTGAAATCCTTGGAACTTACTGG - Intronic
972312117 4:37891272-37891294 GGGGCATCCTGGGGACGGCCTGG - Exonic
976865453 4:89720748-89720770 GTGGAATACTTAGGACTGCCTGG - Intergenic
978546443 4:109876225-109876247 GTGGCATCCTTGGAACTATCTGG - Intergenic
978546879 4:109879808-109879830 GTGACATCATTGAGAATTCCAGG - Intergenic
978565231 4:110074133-110074155 TTGGTATCCTGGGGAGTTCCTGG - Intronic
980312462 4:131150379-131150401 TTGGTATCCTTGGGGATTCCTGG - Intergenic
980988724 4:139719562-139719584 CTGGCATGCCTGGGACTCCCTGG + Exonic
987851252 5:23358201-23358223 GTGTAATCCCTGGGAGTTCCAGG - Intergenic
990522218 5:56591245-56591267 GTCTCATCCTGTGGACTTCCTGG - Intronic
991952253 5:71957658-71957680 TTGGCATCCATGGGAGGTCCTGG - Intergenic
994067498 5:95559418-95559440 TTGGTATCCTTGGGAGGTCCTGG + Intronic
994323407 5:98420202-98420224 GAGGCATTCTTGTTACTTCCAGG + Intergenic
998474452 5:142408737-142408759 TTGGCATCCTTCGGCCTTCTTGG + Intergenic
1001815304 5:174663739-174663761 GAGGCTTGCTAGGGACTTCCAGG + Intergenic
1001975898 5:175998112-175998134 GTGGCAGCCCTGTGACTGCCCGG + Intronic
1002241528 5:177845660-177845682 GTGGCAGCCCTGTGACTGCCCGG - Intergenic
1002424260 5:179166337-179166359 GTGGGATCCCTGGGTCTTTCAGG - Intronic
1004703130 6:18097864-18097886 GTGGCTTTCTTGGCACTTCTGGG + Intergenic
1005699359 6:28384370-28384392 GAGCCCTTCTTGGGACTTCCAGG + Intronic
1008528087 6:52427908-52427930 GTGGCATTCTGAGCACTTCCTGG + Intronic
1012439776 6:99252529-99252551 GTGGCATACATGGCACTTCTAGG - Intergenic
1015881971 6:137878998-137879020 GAGGCAGGCTTGGCACTTCCCGG - Exonic
1016684617 6:146867168-146867190 GTGGAATCCTTGGGGCTTCAGGG - Intergenic
1018797858 6:167201153-167201175 TCGGAATCCTTGGGCCTTCCCGG - Intergenic
1019663215 7:2237390-2237412 GCTGCATGCTTGTGACTTCCGGG + Intronic
1021988128 7:26117067-26117089 GTGGCATCCCAGTGACATCCAGG - Intergenic
1022386665 7:29905776-29905798 GTGGCCTCCTGGGGATTTCAAGG + Intronic
1023402809 7:39802737-39802759 GTAGCAGCATGGGGACTTCCAGG - Intergenic
1024646821 7:51377900-51377922 GTAGCAGCATGGGGACTTCCAGG + Intergenic
1028105333 7:86869957-86869979 TTGGTATCCTTTGGACTTACTGG - Intergenic
1028532308 7:91851573-91851595 GTGGCAATCTGGGAACTTCCAGG + Intronic
1028580522 7:92404704-92404726 ATGGAAACCTTGGGACTTCCTGG + Intergenic
1033682769 7:143612001-143612023 GTGGGATCCTTTGAACTTCATGG + Intergenic
1033701846 7:143845642-143845664 GTGGGATCCTTTGAACTTCATGG - Intergenic
1034285971 7:149883197-149883219 GCGGCATCCCTGGGACCACCTGG - Intergenic
1037459171 8:19092206-19092228 CAGGAATCCTTGGGATTTCCTGG - Intergenic
1039838166 8:41274054-41274076 GTGGCCTCCTGGGGGCTTTCAGG + Intronic
1040284288 8:46092092-46092114 GGGGCACCCTTGGGGCTTCTGGG - Intergenic
1041260905 8:56019792-56019814 GTAGCTTCCCTGGGACATCCTGG + Intergenic
1041730145 8:61054345-61054367 GTGGCATCCTGTGGGCTGCCAGG + Intergenic
1042813832 8:72855819-72855841 GTGGTATCCGTGGGAGGTCCTGG - Intronic
1045418790 8:101993546-101993568 TTCCCATCCTTGGGACTTCCTGG - Intronic
1046723862 8:117653408-117653430 GTGGCATCCCAGTGACTTTCAGG + Intergenic
1047310125 8:123684961-123684983 GTGGCATCCTCGGGCCCTCCCGG + Intronic
1048375000 8:133815512-133815534 TTGGTATCCTTGGGAGGTCCTGG - Intergenic
1049683179 8:143928885-143928907 GTGGCGGCCGGGGGACTTCCTGG - Intronic
1050343489 9:4663286-4663308 GTGGAAACCTTCAGACTTCCTGG - Exonic
1056957753 9:91096082-91096104 GTGGCATCCTTTGGGATACCAGG - Intergenic
1057704224 9:97386319-97386341 GTGGCAGCCCTGAGACTACCTGG + Intergenic
1057842236 9:98495485-98495507 ATGTTATCCTGGGGACTTCCTGG - Intronic
1059412945 9:114144832-114144854 GTGGGATCCTTAGGACTTCATGG - Intergenic
1060904021 9:127288323-127288345 GACACATGCTTGGGACTTCCTGG - Intronic
1061056319 9:128224716-128224738 GTGTCATCTTTGGGAGCTCCAGG + Intronic
1061281794 9:129601905-129601927 ATGGCCTCCATGGGCCTTCCAGG - Intergenic
1061296988 9:129682138-129682160 GTGGGATCCATGTGACATCCTGG - Intronic
1186154188 X:6708471-6708493 GTGGAATCCTTGGGGCCTCTGGG + Intergenic
1187389593 X:18877248-18877270 GTGTCTTCCTTGGTCCTTCCAGG + Intergenic
1187568618 X:20477934-20477956 GTGGCTGCCTTGGAACCTCCAGG + Intergenic
1196710860 X:118760780-118760802 TTGGTATCCTTGGAAGTTCCTGG - Intronic
1196941691 X:120783027-120783049 GTGGCATTCTTTTGACTTCTAGG - Intergenic