ID: 905805474

View in Genome Browser
Species Human (GRCh38)
Location 1:40873954-40873976
Sequence CTGTGGGTAGGGAGGGACAA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905805464_905805474 18 Left 905805464 1:40873913-40873935 CCTACACTTGCCTGCTCAAGCAA No data
Right 905805474 1:40873954-40873976 CTGTGGGTAGGGAGGGACAACGG No data
905805462_905805474 26 Left 905805462 1:40873905-40873927 CCTCATGCCCTACACTTGCCTGC No data
Right 905805474 1:40873954-40873976 CTGTGGGTAGGGAGGGACAACGG No data
905805463_905805474 19 Left 905805463 1:40873912-40873934 CCCTACACTTGCCTGCTCAAGCA No data
Right 905805474 1:40873954-40873976 CTGTGGGTAGGGAGGGACAACGG No data
905805465_905805474 8 Left 905805465 1:40873923-40873945 CCTGCTCAAGCAAGCGATTGTCA No data
Right 905805474 1:40873954-40873976 CTGTGGGTAGGGAGGGACAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905805474 Original CRISPR CTGTGGGTAGGGAGGGACAA CGG Intergenic
No off target data available for this crispr