ID: 905805598

View in Genome Browser
Species Human (GRCh38)
Location 1:40874762-40874784
Sequence ATGTTTTTATATATGCTACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905805597_905805598 -7 Left 905805597 1:40874746-40874768 CCTTATAGTAATAGGTATGTTTT No data
Right 905805598 1:40874762-40874784 ATGTTTTTATATATGCTACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905805598 Original CRISPR ATGTTTTTATATATGCTACA TGG Intergenic
No off target data available for this crispr