ID: 905812768

View in Genome Browser
Species Human (GRCh38)
Location 1:40925193-40925215
Sequence GTTAGGCATGGCTATTAGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905812763_905812768 15 Left 905812763 1:40925155-40925177 CCATCATTTATTAAGCACGTACT No data
Right 905812768 1:40925193-40925215 GTTAGGCATGGCTATTAGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905812768 Original CRISPR GTTAGGCATGGCTATTAGTA TGG Intergenic
No off target data available for this crispr