ID: 905819699

View in Genome Browser
Species Human (GRCh38)
Location 1:40979915-40979937
Sequence GACGTCCGTCACCGCGGCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 40
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 37}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905819699_905819709 23 Left 905819699 1:40979915-40979937 CCGCCGCCGCGGTGACGGACGTC 0: 1
1: 0
2: 0
3: 2
4: 37
Right 905819709 1:40979961-40979983 TGACTCGGCGTCCTGCCCAATGG 0: 1
1: 0
2: 0
3: 3
4: 42
905819699_905819705 0 Left 905819699 1:40979915-40979937 CCGCCGCCGCGGTGACGGACGTC 0: 1
1: 0
2: 0
3: 2
4: 37
Right 905819705 1:40979938-40979960 GCTCCTACCAATCAGGGGCGAGG 0: 1
1: 0
2: 0
3: 4
4: 48
905819699_905819703 -6 Left 905819699 1:40979915-40979937 CCGCCGCCGCGGTGACGGACGTC 0: 1
1: 0
2: 0
3: 2
4: 37
Right 905819703 1:40979932-40979954 GACGTCGCTCCTACCAATCAGGG 0: 1
1: 0
2: 0
3: 0
4: 15
905819699_905819704 -5 Left 905819699 1:40979915-40979937 CCGCCGCCGCGGTGACGGACGTC 0: 1
1: 0
2: 0
3: 2
4: 37
Right 905819704 1:40979933-40979955 ACGTCGCTCCTACCAATCAGGGG 0: 1
1: 0
2: 0
3: 2
4: 15
905819699_905819702 -7 Left 905819699 1:40979915-40979937 CCGCCGCCGCGGTGACGGACGTC 0: 1
1: 0
2: 0
3: 2
4: 37
Right 905819702 1:40979931-40979953 GGACGTCGCTCCTACCAATCAGG 0: 1
1: 0
2: 0
3: 2
4: 8
905819699_905819710 24 Left 905819699 1:40979915-40979937 CCGCCGCCGCGGTGACGGACGTC 0: 1
1: 0
2: 0
3: 2
4: 37
Right 905819710 1:40979962-40979984 GACTCGGCGTCCTGCCCAATGGG 0: 1
1: 0
2: 0
3: 3
4: 34
905819699_905819708 8 Left 905819699 1:40979915-40979937 CCGCCGCCGCGGTGACGGACGTC 0: 1
1: 0
2: 0
3: 2
4: 37
Right 905819708 1:40979946-40979968 CAATCAGGGGCGAGGTGACTCGG 0: 1
1: 0
2: 0
3: 11
4: 313

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905819699 Original CRISPR GACGTCCGTCACCGCGGCGG CGG (reversed) Intronic
901633094 1:10657340-10657362 GCCGGCCGTCACCGAGGCTGTGG - Intronic
905819699 1:40979915-40979937 GACGTCCGTCACCGCGGCGGCGG - Intronic
917869640 1:179229748-179229770 GCCCTCCTTCCCCGCGGCGGAGG - Intergenic
917904477 1:179575664-179575686 CACGTCCACCACCGTGGCGGCGG + Exonic
920039331 1:203085507-203085529 GACCTCCGCTACCGGGGCGGGGG - Exonic
923141429 1:231163563-231163585 GACGTCTGCAGCCGCGGCGGTGG + Exonic
1082050505 11:47767097-47767119 GGCGGCAGTCACCGCGGTGGTGG + Exonic
1083855787 11:65392432-65392454 GATGTCCGTCACCGGGGTGCAGG - Intronic
1097891367 12:64780812-64780834 GACGTCCTTCCCACCGGCGGGGG + Intergenic
1106517017 13:30464938-30464960 GGCGGCCCCCACCGCGGCGGGGG - Intronic
1113755817 13:112809924-112809946 CAGGTCCGTCAGCGCGGCCGGGG + Intronic
1147335169 17:39723325-39723347 GACGTCCATCATCTCTGCGGTGG + Exonic
1147719808 17:42532131-42532153 GACGCCCGGCCCGGCGGCGGCGG - Intergenic
1151601775 17:75110270-75110292 GTCCTCCGTCACCGCGGCCATGG + Exonic
1157571539 18:48715615-48715637 GAGGTCCCTCACCGCTGGGGAGG + Intronic
1160767515 19:815035-815057 CACGTCCGTCACCAGGGCTGTGG + Exonic
1161802745 19:6424861-6424883 GTCGTCCGTCACGTCGGCGGCGG - Intergenic
1163122010 19:15223787-15223809 GACGTCGGAGCCCGCGGCGGAGG - Intergenic
1166705476 19:44905804-44905826 GACGTCCTTCACCTCCGCTGGGG - Exonic
1167258108 19:48443027-48443049 GACGGCGGTGGCCGCGGCGGCGG - Exonic
930011414 2:46941023-46941045 GAGCTCCGACTCCGCGGCGGGGG + Intronic
944811094 2:203328302-203328324 GAGGACGGTCACCGCGGCGACGG - Exonic
1172367970 20:34363930-34363952 GACGTCCGCCACCGTCGTGGCGG + Intronic
1176548599 21:8212238-8212260 GACGGCCGCCGCGGCGGCGGCGG - Intergenic
1176556493 21:8256446-8256468 GACGGCCGCCGCGGCGGCGGCGG - Intergenic
1176567530 21:8395273-8395295 GACGGCCGCCGCGGCGGCGGCGG - Intergenic
1176575432 21:8439488-8439510 GACGGCCGCCGCGGCGGCGGCGG - Intergenic
1203261537 22_KI270733v1_random:173621-173643 GACGGCCGCCGCGGCGGCGGCGG - Intergenic
954176233 3:48847814-48847836 CCCGTCGGTCCCCGCGGCGGCGG - Exonic
998385163 5:141753312-141753334 AACGTCCCTCCCCGGGGCGGGGG + Intergenic
999135526 5:149316269-149316291 GACGTCCTCCACCGAGGAGGAGG + Exonic
1002925776 6:1604998-1605020 GACGTCCCTCACCCCGGCCGGGG - Intergenic
1007431525 6:41779914-41779936 GACCTCCGACCCCGCGGCCGCGG - Intronic
1019474253 7:1236442-1236464 GAAGTCCAGCCCCGCGGCGGCGG - Exonic
1037828925 8:22176971-22176993 TACGTGGGTCGCCGCGGCGGGGG + Exonic
1049710528 8:144061002-144061024 GACGTCCTTCCCCGTGGAGGGGG + Intronic
1057489152 9:95508378-95508400 AGCCTCCGTCCCCGCGGCGGCGG - Exonic
1203469883 Un_GL000220v1:111690-111712 GACGGCCGCCGCGGCGGCGGCGG - Intergenic
1203477704 Un_GL000220v1:155662-155684 GACGGCCGCCGCGGCGGCGGCGG - Intergenic
1199445102 X:147912037-147912059 GGCGTGCGGCAGCGCGGCGGCGG + Exonic