ID: 905819699

View in Genome Browser
Species Human (GRCh38)
Location 1:40979915-40979937
Sequence GACGTCCGTCACCGCGGCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 40
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 37}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905819699_905819705 0 Left 905819699 1:40979915-40979937 CCGCCGCCGCGGTGACGGACGTC 0: 1
1: 0
2: 0
3: 2
4: 37
Right 905819705 1:40979938-40979960 GCTCCTACCAATCAGGGGCGAGG 0: 1
1: 0
2: 0
3: 4
4: 48
905819699_905819709 23 Left 905819699 1:40979915-40979937 CCGCCGCCGCGGTGACGGACGTC 0: 1
1: 0
2: 0
3: 2
4: 37
Right 905819709 1:40979961-40979983 TGACTCGGCGTCCTGCCCAATGG 0: 1
1: 0
2: 0
3: 3
4: 42
905819699_905819708 8 Left 905819699 1:40979915-40979937 CCGCCGCCGCGGTGACGGACGTC 0: 1
1: 0
2: 0
3: 2
4: 37
Right 905819708 1:40979946-40979968 CAATCAGGGGCGAGGTGACTCGG 0: 1
1: 0
2: 0
3: 11
4: 313
905819699_905819702 -7 Left 905819699 1:40979915-40979937 CCGCCGCCGCGGTGACGGACGTC 0: 1
1: 0
2: 0
3: 2
4: 37
Right 905819702 1:40979931-40979953 GGACGTCGCTCCTACCAATCAGG 0: 1
1: 0
2: 0
3: 2
4: 8
905819699_905819703 -6 Left 905819699 1:40979915-40979937 CCGCCGCCGCGGTGACGGACGTC 0: 1
1: 0
2: 0
3: 2
4: 37
Right 905819703 1:40979932-40979954 GACGTCGCTCCTACCAATCAGGG 0: 1
1: 0
2: 0
3: 0
4: 15
905819699_905819710 24 Left 905819699 1:40979915-40979937 CCGCCGCCGCGGTGACGGACGTC 0: 1
1: 0
2: 0
3: 2
4: 37
Right 905819710 1:40979962-40979984 GACTCGGCGTCCTGCCCAATGGG 0: 1
1: 0
2: 0
3: 3
4: 34
905819699_905819704 -5 Left 905819699 1:40979915-40979937 CCGCCGCCGCGGTGACGGACGTC 0: 1
1: 0
2: 0
3: 2
4: 37
Right 905819704 1:40979933-40979955 ACGTCGCTCCTACCAATCAGGGG 0: 1
1: 0
2: 0
3: 2
4: 15

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905819699 Original CRISPR GACGTCCGTCACCGCGGCGG CGG (reversed) Intronic