ID: 905819702

View in Genome Browser
Species Human (GRCh38)
Location 1:40979931-40979953
Sequence GGACGTCGCTCCTACCAATC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 11
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 8}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905819697_905819702 -5 Left 905819697 1:40979913-40979935 CCCCGCCGCCGCGGTGACGGACG 0: 1
1: 0
2: 0
3: 2
4: 49
Right 905819702 1:40979931-40979953 GGACGTCGCTCCTACCAATCAGG 0: 1
1: 0
2: 0
3: 2
4: 8
905819699_905819702 -7 Left 905819699 1:40979915-40979937 CCGCCGCCGCGGTGACGGACGTC 0: 1
1: 0
2: 0
3: 2
4: 37
Right 905819702 1:40979931-40979953 GGACGTCGCTCCTACCAATCAGG 0: 1
1: 0
2: 0
3: 2
4: 8
905819700_905819702 -10 Left 905819700 1:40979918-40979940 CCGCCGCGGTGACGGACGTCGCT 0: 1
1: 0
2: 0
3: 0
4: 10
Right 905819702 1:40979931-40979953 GGACGTCGCTCCTACCAATCAGG 0: 1
1: 0
2: 0
3: 2
4: 8
905819693_905819702 9 Left 905819693 1:40979899-40979921 CCGGCGCCGAATAGCCCCGCCGC 0: 1
1: 0
2: 0
3: 4
4: 52
Right 905819702 1:40979931-40979953 GGACGTCGCTCCTACCAATCAGG 0: 1
1: 0
2: 0
3: 2
4: 8
905819692_905819702 10 Left 905819692 1:40979898-40979920 CCCGGCGCCGAATAGCCCCGCCG 0: 1
1: 0
2: 0
3: 3
4: 34
Right 905819702 1:40979931-40979953 GGACGTCGCTCCTACCAATCAGG 0: 1
1: 0
2: 0
3: 2
4: 8
905819695_905819702 3 Left 905819695 1:40979905-40979927 CCGAATAGCCCCGCCGCCGCGGT 0: 1
1: 0
2: 0
3: 2
4: 26
Right 905819702 1:40979931-40979953 GGACGTCGCTCCTACCAATCAGG 0: 1
1: 0
2: 0
3: 2
4: 8
905819698_905819702 -6 Left 905819698 1:40979914-40979936 CCCGCCGCCGCGGTGACGGACGT 0: 1
1: 0
2: 0
3: 2
4: 22
Right 905819702 1:40979931-40979953 GGACGTCGCTCCTACCAATCAGG 0: 1
1: 0
2: 0
3: 2
4: 8

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905819702 Original CRISPR GGACGTCGCTCCTACCAATC AGG Intronic
905819702 1:40979931-40979953 GGACGTCGCTCCTACCAATCAGG + Intronic
912679312 1:111719087-111719109 GGACGTAGCTCCTACCTGGCAGG + Intronic
1080795644 11:35560447-35560469 GGATGTGGCTCCTACCAAGCTGG + Intergenic
1084329950 11:68424405-68424427 GGCCGTCACTCCTACCAATGAGG - Intronic
1118640113 14:67784319-67784341 GGAGGTGGCTCCTACCTCTCTGG + Exonic
1141462339 16:84184922-84184944 GGACGTCGCTCAGACCAAGGGGG + Exonic
1145030424 17:19500981-19501003 AGACTTCGCTCCTAAGAATCTGG + Intronic
1171403651 20:24895010-24895032 GGAAGTCGATCATACAAATCAGG + Intergenic
1180887574 22:19258046-19258068 GGATGTCGCTCCTCACAAACTGG - Intronic
1184502051 22:44880264-44880286 GGACCTCACTCCTGCCAATGTGG - Intergenic
1062530079 9:136995875-136995897 GGAAGTCGCGCCGACCAAGCTGG - Intronic