ID: 905819703

View in Genome Browser
Species Human (GRCh38)
Location 1:40979932-40979954
Sequence GACGTCGCTCCTACCAATCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 16
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 15}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905819699_905819703 -6 Left 905819699 1:40979915-40979937 CCGCCGCCGCGGTGACGGACGTC 0: 1
1: 0
2: 0
3: 2
4: 37
Right 905819703 1:40979932-40979954 GACGTCGCTCCTACCAATCAGGG 0: 1
1: 0
2: 0
3: 0
4: 15
905819698_905819703 -5 Left 905819698 1:40979914-40979936 CCCGCCGCCGCGGTGACGGACGT 0: 1
1: 0
2: 0
3: 2
4: 22
Right 905819703 1:40979932-40979954 GACGTCGCTCCTACCAATCAGGG 0: 1
1: 0
2: 0
3: 0
4: 15
905819693_905819703 10 Left 905819693 1:40979899-40979921 CCGGCGCCGAATAGCCCCGCCGC 0: 1
1: 0
2: 0
3: 4
4: 52
Right 905819703 1:40979932-40979954 GACGTCGCTCCTACCAATCAGGG 0: 1
1: 0
2: 0
3: 0
4: 15
905819695_905819703 4 Left 905819695 1:40979905-40979927 CCGAATAGCCCCGCCGCCGCGGT 0: 1
1: 0
2: 0
3: 2
4: 26
Right 905819703 1:40979932-40979954 GACGTCGCTCCTACCAATCAGGG 0: 1
1: 0
2: 0
3: 0
4: 15
905819700_905819703 -9 Left 905819700 1:40979918-40979940 CCGCCGCGGTGACGGACGTCGCT 0: 1
1: 0
2: 0
3: 0
4: 10
Right 905819703 1:40979932-40979954 GACGTCGCTCCTACCAATCAGGG 0: 1
1: 0
2: 0
3: 0
4: 15
905819692_905819703 11 Left 905819692 1:40979898-40979920 CCCGGCGCCGAATAGCCCCGCCG 0: 1
1: 0
2: 0
3: 3
4: 34
Right 905819703 1:40979932-40979954 GACGTCGCTCCTACCAATCAGGG 0: 1
1: 0
2: 0
3: 0
4: 15
905819697_905819703 -4 Left 905819697 1:40979913-40979935 CCCCGCCGCCGCGGTGACGGACG 0: 1
1: 0
2: 0
3: 2
4: 49
Right 905819703 1:40979932-40979954 GACGTCGCTCCTACCAATCAGGG 0: 1
1: 0
2: 0
3: 0
4: 15

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905819703 Original CRISPR GACGTCGCTCCTACCAATCA GGG Intronic
905819703 1:40979932-40979954 GACGTCGCTCCTACCAATCAGGG + Intronic
908992668 1:70112413-70112435 GACTTCCCTCCTACCTATTAAGG - Intronic
1081699741 11:45145653-45145675 GACGTCTCTCCTACCAAGGGAGG - Intronic
1087453206 11:98351564-98351586 GAGATTGCTCATACCAATCATGG - Intergenic
1111240904 13:85473557-85473579 GACGTCACATCTACCAATGATGG - Intergenic
1133701474 16:8313328-8313350 GACCTTGCTCCTTCCAATCCTGG - Intergenic
1135094687 16:19555444-19555466 GACGTTGCTCCTCCGAAGCATGG + Exonic
1138398957 16:56730270-56730292 GACGGCGCTCCACCCAGTCACGG - Intronic
937050899 2:118888345-118888367 GACTTAGCTCCTACTAGTCACGG - Intergenic
944867604 2:203877939-203877961 GACGTCCCTGCTACCACTCCAGG + Intergenic
957038779 3:75320056-75320078 GACCTCGCTCCTGTCCATCAAGG + Intergenic
961086814 3:124075356-124075378 GACCTCGCTCCTGTCCATCAAGG + Intergenic
971774589 4:30946357-30946379 TATGTCTCTCCTACCTATCAAGG + Intronic
1015243180 6:131049058-131049080 GATGTGGCTCCTACCAATTGAGG - Intronic
1026852177 7:73731615-73731637 GACGTTGGTACTACCATTCATGG + Intergenic
1037667541 8:20983260-20983282 GTCCTCCCTCCTACCTATCATGG + Intergenic