ID: 905819704

View in Genome Browser
Species Human (GRCh38)
Location 1:40979933-40979955
Sequence ACGTCGCTCCTACCAATCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 18
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 15}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905819692_905819704 12 Left 905819692 1:40979898-40979920 CCCGGCGCCGAATAGCCCCGCCG 0: 1
1: 0
2: 0
3: 3
4: 34
Right 905819704 1:40979933-40979955 ACGTCGCTCCTACCAATCAGGGG 0: 1
1: 0
2: 0
3: 2
4: 15
905819697_905819704 -3 Left 905819697 1:40979913-40979935 CCCCGCCGCCGCGGTGACGGACG 0: 1
1: 0
2: 0
3: 2
4: 49
Right 905819704 1:40979933-40979955 ACGTCGCTCCTACCAATCAGGGG 0: 1
1: 0
2: 0
3: 2
4: 15
905819695_905819704 5 Left 905819695 1:40979905-40979927 CCGAATAGCCCCGCCGCCGCGGT 0: 1
1: 0
2: 0
3: 2
4: 26
Right 905819704 1:40979933-40979955 ACGTCGCTCCTACCAATCAGGGG 0: 1
1: 0
2: 0
3: 2
4: 15
905819700_905819704 -8 Left 905819700 1:40979918-40979940 CCGCCGCGGTGACGGACGTCGCT 0: 1
1: 0
2: 0
3: 0
4: 10
Right 905819704 1:40979933-40979955 ACGTCGCTCCTACCAATCAGGGG 0: 1
1: 0
2: 0
3: 2
4: 15
905819699_905819704 -5 Left 905819699 1:40979915-40979937 CCGCCGCCGCGGTGACGGACGTC 0: 1
1: 0
2: 0
3: 2
4: 37
Right 905819704 1:40979933-40979955 ACGTCGCTCCTACCAATCAGGGG 0: 1
1: 0
2: 0
3: 2
4: 15
905819693_905819704 11 Left 905819693 1:40979899-40979921 CCGGCGCCGAATAGCCCCGCCGC 0: 1
1: 0
2: 0
3: 4
4: 52
Right 905819704 1:40979933-40979955 ACGTCGCTCCTACCAATCAGGGG 0: 1
1: 0
2: 0
3: 2
4: 15
905819698_905819704 -4 Left 905819698 1:40979914-40979936 CCCGCCGCCGCGGTGACGGACGT 0: 1
1: 0
2: 0
3: 2
4: 22
Right 905819704 1:40979933-40979955 ACGTCGCTCCTACCAATCAGGGG 0: 1
1: 0
2: 0
3: 2
4: 15

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905819704 Original CRISPR ACGTCGCTCCTACCAATCAG GGG Intronic
905819704 1:40979933-40979955 ACGTCGCTCCTACCAATCAGGGG + Intronic
912457878 1:109810655-109810677 ACGAGCCTCCTGCCAATCAGTGG - Intergenic
1081677621 11:44980188-44980210 ACGTGGCTCTCACAAATCAGAGG + Intergenic
1106317742 13:28609761-28609783 ACGTGGTACCTACCAATGAGAGG - Intergenic
1118944984 14:70376403-70376425 AGGTCACTCCTACCACTTAGAGG + Intronic
1119629190 14:76211410-76211432 CAGTAGCTCCTACCAATAAGTGG - Exonic
1125918016 15:43506840-43506862 ACTTGGCTCCCACCAATCAGAGG - Intronic
1125992835 15:44126910-44126932 ACTTCCCTCATACCAATCACTGG + Intronic
1131279904 15:91012700-91012722 ACGTCATTCCTCCCAATCACTGG + Intronic
1144250234 17:13408999-13409021 AAGTCACTCCTCCCAATAAGAGG - Intergenic
1170051887 20:12155271-12155293 AGGTCGTTCCTGCCATTCAGTGG - Intergenic
980135758 4:128857226-128857248 ACATCTCTCCTACCAGACAGTGG - Intronic
982199062 4:152942485-152942507 ACATGTCTCCTACCAATCAGTGG - Intronic
992461965 5:76969108-76969130 ACTATGATCCTACCAATCAGGGG - Exonic
994049385 5:95345327-95345349 ACGACTCTCCATCCAATCAGAGG + Intergenic
1002456922 5:179350545-179350567 AGGTCGCTCCTACCAGCGAGAGG - Intergenic
1037655723 8:20882669-20882691 ACCTCGCTCCTGCCACACAGTGG - Intergenic
1038267640 8:26048569-26048591 AAGTCTCTCCTCCCGATCAGAGG + Intergenic