ID: 905819705

View in Genome Browser
Species Human (GRCh38)
Location 1:40979938-40979960
Sequence GCTCCTACCAATCAGGGGCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 48}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905819698_905819705 1 Left 905819698 1:40979914-40979936 CCCGCCGCCGCGGTGACGGACGT 0: 1
1: 0
2: 0
3: 2
4: 22
Right 905819705 1:40979938-40979960 GCTCCTACCAATCAGGGGCGAGG 0: 1
1: 0
2: 0
3: 4
4: 48
905819695_905819705 10 Left 905819695 1:40979905-40979927 CCGAATAGCCCCGCCGCCGCGGT 0: 1
1: 0
2: 0
3: 2
4: 26
Right 905819705 1:40979938-40979960 GCTCCTACCAATCAGGGGCGAGG 0: 1
1: 0
2: 0
3: 4
4: 48
905819699_905819705 0 Left 905819699 1:40979915-40979937 CCGCCGCCGCGGTGACGGACGTC 0: 1
1: 0
2: 0
3: 2
4: 37
Right 905819705 1:40979938-40979960 GCTCCTACCAATCAGGGGCGAGG 0: 1
1: 0
2: 0
3: 4
4: 48
905819701_905819705 -6 Left 905819701 1:40979921-40979943 CCGCGGTGACGGACGTCGCTCCT 0: 1
1: 0
2: 0
3: 0
4: 10
Right 905819705 1:40979938-40979960 GCTCCTACCAATCAGGGGCGAGG 0: 1
1: 0
2: 0
3: 4
4: 48
905819692_905819705 17 Left 905819692 1:40979898-40979920 CCCGGCGCCGAATAGCCCCGCCG 0: 1
1: 0
2: 0
3: 3
4: 34
Right 905819705 1:40979938-40979960 GCTCCTACCAATCAGGGGCGAGG 0: 1
1: 0
2: 0
3: 4
4: 48
905819700_905819705 -3 Left 905819700 1:40979918-40979940 CCGCCGCGGTGACGGACGTCGCT 0: 1
1: 0
2: 0
3: 0
4: 10
Right 905819705 1:40979938-40979960 GCTCCTACCAATCAGGGGCGAGG 0: 1
1: 0
2: 0
3: 4
4: 48
905819697_905819705 2 Left 905819697 1:40979913-40979935 CCCCGCCGCCGCGGTGACGGACG 0: 1
1: 0
2: 0
3: 2
4: 49
Right 905819705 1:40979938-40979960 GCTCCTACCAATCAGGGGCGAGG 0: 1
1: 0
2: 0
3: 4
4: 48
905819693_905819705 16 Left 905819693 1:40979899-40979921 CCGGCGCCGAATAGCCCCGCCGC 0: 1
1: 0
2: 0
3: 4
4: 52
Right 905819705 1:40979938-40979960 GCTCCTACCAATCAGGGGCGAGG 0: 1
1: 0
2: 0
3: 4
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905819705 Original CRISPR GCTCCTACCAATCAGGGGCG AGG Intronic
900981091 1:6046712-6046734 GCTGCTACCATTCCGGGGTGCGG - Intronic
905819705 1:40979938-40979960 GCTCCTACCAATCAGGGGCGAGG + Intronic
908356594 1:63329337-63329359 GCTCCATCCCATCAGGGGTGAGG + Intergenic
916909093 1:169325313-169325335 GCTCCTCTCAATCAGTGGCTGGG + Intronic
1073379557 10:103067417-103067439 CCTCCTACAAATCAGGGGAGGGG - Intronic
1074770294 10:116729230-116729252 GCTCTTACCAGTCAGGGGTTGGG - Intronic
1084539108 11:69775468-69775490 CCGCCTGCCAATCAGGGCCGGGG + Intergenic
1089278590 11:117356479-117356501 CCTCTTGCCAAGCAGGGGCGAGG - Intronic
1089999040 11:122937868-122937890 CAAGCTACCAATCAGGGGCGAGG - Intronic
1091239556 11:134043444-134043466 GGCCCTACCCACCAGGGGCGGGG - Intergenic
1095283481 12:40384113-40384135 GCTCCTCCCAATCAGGCTAGAGG + Intergenic
1101676263 12:106919595-106919617 GATCCTCACAATCAGGGGCAAGG - Intergenic
1104800861 12:131554525-131554547 GCTCCTGCCCATCAGGGCCGTGG - Intergenic
1127865674 15:63030657-63030679 GCTCCTTAAAATCAGGGGCCAGG + Intergenic
1129001754 15:72341401-72341423 GCTCCTACCAAGGAGAGGAGAGG + Exonic
1132220102 15:100098972-100098994 ACTCCTACCAAGCAAGGGTGTGG - Intronic
1137256225 16:46777842-46777864 GCTCCAACTTAGCAGGGGCGGGG - Intronic
1137637102 16:49996194-49996216 GCTTCTTCCAGTCAGGGGAGGGG - Intergenic
1162692065 19:12441127-12441149 GCCCTATCCAATCAGGGGCGTGG - Intronic
1168323800 19:55526505-55526527 GCAGCTGCCAAGCAGGGGCGGGG + Intergenic
925421983 2:3719848-3719870 GCTCCTTCAAATCAGAGGCGAGG + Intronic
934773346 2:96921765-96921787 GCTCCTACCCAACATGGCCGCGG - Intronic
937005245 2:118506153-118506175 GCTCCAACCAATCAGTGACAAGG + Intergenic
938724283 2:134093167-134093189 GCTCCTAGAAACCAAGGGCGTGG - Intergenic
938761669 2:134431633-134431655 GCTCCTACCATTCAAGGGATGGG - Intronic
1174393889 20:50234182-50234204 GCTCCCACCCATCAGGGCAGAGG - Intergenic
1183062392 22:35344305-35344327 GCTCCTGCCAGGCATGGGCGTGG + Intronic
1183391874 22:37549967-37549989 GCGCCTACCAAGCAGGAGGGGGG - Intergenic
1184766357 22:46574612-46574634 GCCCCTACCAAGCAGGGACTGGG + Intergenic
952274741 3:31866326-31866348 GCACCTGGCAAGCAGGGGCGAGG + Intronic
962010119 3:131383706-131383728 GCTCCTTGCAATCAGGGACCAGG - Intronic
983891037 4:173030602-173030624 TTTCCTACCAAGCAGGTGCGGGG + Intronic
985770907 5:1810160-1810182 GCTGCTTCCACTCTGGGGCGGGG + Intronic
986413527 5:7505505-7505527 GCTCCAACCCATCAGGGGGATGG - Intronic
990435356 5:55784568-55784590 GCTCTTACCAATCAGGATGGTGG - Intronic
1007697375 6:43742484-43742506 GCTCCTAACAGGCAGGGGCCAGG - Intergenic
1019417232 7:933445-933467 GCTACTCCCAACCAGGGGCAGGG + Intronic
1023855145 7:44178386-44178408 ACTCCTTCCCATCAGGGCCGTGG - Intronic
1024560401 7:50640105-50640127 GCTCCTCCCAAACAGGGGCAGGG + Intronic
1029134550 7:98359875-98359897 GGTCCTACCTATCAGGAGCCTGG - Intronic
1034260264 7:149751092-149751114 GCTGCTGCCAATCAGGGCTGAGG + Intergenic
1036133167 8:6135141-6135163 GCTCCTACCAGCCAGGCGCTGGG + Intergenic
1049162751 8:141108097-141108119 GCTGCTACCAAACAGAGGTGTGG - Intergenic
1060999961 9:127897445-127897467 GATCTAACCAATCAGGAGCGAGG - Intronic
1186341928 X:8654726-8654748 GCTCCTTAAAATCAGGGGCCGGG + Intronic
1187341483 X:18425457-18425479 GCTCCTACCAGAAGGGGGCGGGG + Intergenic
1188292825 X:28410069-28410091 ACTCGTACCAATCAGTGGCCTGG - Intergenic
1188369076 X:29347068-29347090 TCTCCTACAAATAAGGGGTGGGG - Intronic
1192017118 X:67343077-67343099 GCACCTATAAATCAGGGGTGAGG + Intergenic
1200181423 X:154153084-154153106 GCTCCAACCAAAGATGGGCGGGG - Exonic
1200187069 X:154190198-154190220 GCTCCAACCAAAGATGGGCGGGG - Intergenic
1200192718 X:154227336-154227358 GCTCCAACCAAAGATGGGCGGGG - Exonic
1200198473 X:154265140-154265162 GCTCCAACCAAAGATGGGCGGGG - Exonic