ID: 905819708

View in Genome Browser
Species Human (GRCh38)
Location 1:40979946-40979968
Sequence CAATCAGGGGCGAGGTGACT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 325
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 313}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905819698_905819708 9 Left 905819698 1:40979914-40979936 CCCGCCGCCGCGGTGACGGACGT 0: 1
1: 0
2: 0
3: 2
4: 22
Right 905819708 1:40979946-40979968 CAATCAGGGGCGAGGTGACTCGG 0: 1
1: 0
2: 0
3: 11
4: 313
905819695_905819708 18 Left 905819695 1:40979905-40979927 CCGAATAGCCCCGCCGCCGCGGT 0: 1
1: 0
2: 0
3: 2
4: 26
Right 905819708 1:40979946-40979968 CAATCAGGGGCGAGGTGACTCGG 0: 1
1: 0
2: 0
3: 11
4: 313
905819692_905819708 25 Left 905819692 1:40979898-40979920 CCCGGCGCCGAATAGCCCCGCCG 0: 1
1: 0
2: 0
3: 3
4: 34
Right 905819708 1:40979946-40979968 CAATCAGGGGCGAGGTGACTCGG 0: 1
1: 0
2: 0
3: 11
4: 313
905819697_905819708 10 Left 905819697 1:40979913-40979935 CCCCGCCGCCGCGGTGACGGACG 0: 1
1: 0
2: 0
3: 2
4: 49
Right 905819708 1:40979946-40979968 CAATCAGGGGCGAGGTGACTCGG 0: 1
1: 0
2: 0
3: 11
4: 313
905819701_905819708 2 Left 905819701 1:40979921-40979943 CCGCGGTGACGGACGTCGCTCCT 0: 1
1: 0
2: 0
3: 0
4: 10
Right 905819708 1:40979946-40979968 CAATCAGGGGCGAGGTGACTCGG 0: 1
1: 0
2: 0
3: 11
4: 313
905819699_905819708 8 Left 905819699 1:40979915-40979937 CCGCCGCCGCGGTGACGGACGTC 0: 1
1: 0
2: 0
3: 2
4: 37
Right 905819708 1:40979946-40979968 CAATCAGGGGCGAGGTGACTCGG 0: 1
1: 0
2: 0
3: 11
4: 313
905819700_905819708 5 Left 905819700 1:40979918-40979940 CCGCCGCGGTGACGGACGTCGCT 0: 1
1: 0
2: 0
3: 0
4: 10
Right 905819708 1:40979946-40979968 CAATCAGGGGCGAGGTGACTCGG 0: 1
1: 0
2: 0
3: 11
4: 313
905819693_905819708 24 Left 905819693 1:40979899-40979921 CCGGCGCCGAATAGCCCCGCCGC 0: 1
1: 0
2: 0
3: 4
4: 52
Right 905819708 1:40979946-40979968 CAATCAGGGGCGAGGTGACTCGG 0: 1
1: 0
2: 0
3: 11
4: 313

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905819708 Original CRISPR CAATCAGGGGCGAGGTGACT CGG Intronic
901028839 1:6294349-6294371 CAGGCAGGGGCCAGGTGGCTGGG + Intronic
902268517 1:15286619-15286641 CAATCAGAGCCAAGGAGACTAGG - Intronic
902598926 1:17527788-17527810 CACTGAGGGGGTAGGTGACTGGG + Intergenic
904057696 1:27682874-27682896 CAAGCAGGGGGTATGTGACTGGG - Intergenic
904161469 1:28525117-28525139 CAAGCAGGGGATATGTGACTGGG + Intronic
904403284 1:30270735-30270757 CAAGCAGGTAGGAGGTGACTAGG - Intergenic
904483257 1:30807270-30807292 TAATCCGGGGCGAGGCGACAGGG + Intergenic
905819708 1:40979946-40979968 CAATCAGGGGCGAGGTGACTCGG + Intronic
906278684 1:44537745-44537767 CATTCAGGTGATAGGTGACTAGG - Intronic
908838757 1:68256808-68256830 CAAGCAGGGGGTATGTGACTGGG - Intergenic
910531729 1:88243763-88243785 CTATCAGGGGGTAGGAGACTCGG + Intergenic
910852508 1:91662638-91662660 CAAGCAGGGGGTATGTGACTGGG + Intergenic
910853411 1:91670475-91670497 CAAGCAGGGGGTAAGTGACTGGG + Intergenic
912445342 1:109731833-109731855 CAAGCAGGGGATATGTGACTGGG + Intronic
912508226 1:110171193-110171215 CCATCAGGGCCCTGGTGACTGGG + Intronic
915227977 1:154424979-154425001 CAAGCAGGGGGTACGTGACTGGG + Intronic
917492502 1:175509574-175509596 GCATCAGGGGTGAGGTGGCTTGG - Intronic
919390069 1:196972903-196972925 CAGTCAGGGGTGAGATTACTGGG - Intergenic
919753915 1:201054713-201054735 CAATCAGGGGCGGGGTGGGTGGG + Intronic
920322988 1:205138900-205138922 CAAGCAGGGGGTACGTGACTGGG - Intergenic
921738757 1:218659095-218659117 CATTCAGGGGTGAGCTGAGTGGG + Intergenic
922864764 1:228850471-228850493 CAAGCAGGGGGTACGTGACTGGG + Intergenic
924778553 1:247127698-247127720 CAAGCAGGGGGTACGTGACTGGG - Intronic
924779439 1:247132805-247132827 CAAGCAGGGGGTATGTGACTGGG - Intronic
924859418 1:247905621-247905643 CAAGCAGGGGGTACGTGACTGGG + Intergenic
1064155487 10:12900100-12900122 CAATCATGGTGGAGGTGAATAGG - Intronic
1064189721 10:13195170-13195192 CAAGCTGGGGCGAGGTGTCTTGG + Exonic
1064659067 10:17587562-17587584 CAAGCAGGGGGTATGTGACTGGG - Intergenic
1065058559 10:21873093-21873115 CAAGCAGGGGGTACGTGACTGGG - Intronic
1065312356 10:24428525-24428547 AAACCAAGGGCGAGGTTACTAGG + Intronic
1065931386 10:30482211-30482233 CAAGCAGGGGGTACGTGACTGGG - Intergenic
1067420294 10:46139562-46139584 CAAGCAGGGGGTATGTGACTGGG + Intergenic
1067425727 10:46209955-46209977 CAAGCAGGGGGTATGTGACTGGG - Intergenic
1067505637 10:46846047-46846069 CAAGCAGGGGGTATGTGACTGGG + Intergenic
1068189874 10:53637482-53637504 CAAGCAGGGGGTACGTGACTGGG + Intergenic
1068676117 10:59771215-59771237 CAAGCAGGGGGTACGTGACTGGG + Intergenic
1069542850 10:69308465-69308487 CAAGCAGGGGGTATGTGACTGGG + Intronic
1069938844 10:71939628-71939650 CAAGCGGGGGCTATGTGACTGGG - Intergenic
1069939693 10:71946298-71946320 CAAGCGGGGGCTACGTGACTGGG - Intergenic
1069965175 10:72109357-72109379 CAGTCAGTGGAGAGGGGACTTGG - Intronic
1070351722 10:75599028-75599050 CAAGAAGGGGAGAGGTGGCTGGG + Intronic
1070482340 10:76895143-76895165 CAAGCAGGGGGTACGTGACTAGG - Intronic
1071143600 10:82541499-82541521 CAAGCAGGGGGTACGTGACTGGG + Intronic
1071281541 10:84108701-84108723 CAATCAGGGGGTACATGACTGGG - Intergenic
1071282691 10:84116984-84117006 CAATCAGGGGGTACATGACTGGG - Intergenic
1071899823 10:90108176-90108198 CAAGCAGGGGGTACGTGACTGGG + Intergenic
1072155851 10:92723035-92723057 CAAGCAGAGGCCAGGTGACCAGG - Intergenic
1072197385 10:93128203-93128225 CAAGCAGGGGATACGTGACTGGG - Intergenic
1072485257 10:95848404-95848426 GAATCGGGGGAGAGGTGACATGG + Intronic
1074024529 10:109620745-109620767 CAATCAGGGGGTAGGTGAGGTGG + Intergenic
1074378095 10:112955097-112955119 CAATCAGGGGTGAGGTGGGGGGG - Intronic
1076532899 10:131156750-131156772 CAAGCAGGGGGTATGTGACTGGG - Intronic
1077004966 11:350448-350470 CAAGCAGGGGGTATGTGACTGGG + Intergenic
1077126819 11:943305-943327 CAAGCAGGGGGTATGTGACTGGG + Intronic
1077259839 11:1610629-1610651 CAAGCAGGGGGTACGTGACTGGG + Intergenic
1077816559 11:5691322-5691344 CAAGCAGGGGGTACGTGACTGGG + Intronic
1078282783 11:9919526-9919548 CAAGCAGGGGGTACGTGACTGGG + Intronic
1079443971 11:20543028-20543050 CAATAAGGGGCCAGGTGAGGTGG + Intergenic
1081201499 11:40221803-40221825 CAAGCAGGGGGTACGTGACTGGG - Intronic
1081518774 11:43860902-43860924 CAATCAGAGGCCAGGTGCCTTGG - Intergenic
1082621012 11:55422298-55422320 CAAGCAGGGGGTACGTGACTGGG + Intergenic
1082798142 11:57393535-57393557 CAGGAAGGGGTGAGGTGACTGGG - Intronic
1083089526 11:60185695-60185717 CAAGCAGGGGGTATGTGACTGGG - Intergenic
1083090358 11:60192980-60193002 CAAGCAGGGGTTATGTGACTGGG - Intergenic
1083196947 11:61093841-61093863 CAAGCAGGGGGTACGTGACTGGG - Intergenic
1083834981 11:65260811-65260833 CAAGCAGGGGGTACGTGACTGGG - Intergenic
1084932149 11:72564779-72564801 CAAGCAGGGGGTACGTGACTGGG - Intergenic
1085180455 11:74531220-74531242 CAAGCAGGGGGTACGTGACTGGG - Intronic
1085336394 11:75699984-75700006 CAATCAGGAGAGTGGTGACTGGG + Intergenic
1085489508 11:76901696-76901718 CAAGCAGGGGGTACGTGACTGGG + Intronic
1085897216 11:80654466-80654488 CAAGCAGGGGGTACGTGACTGGG + Intergenic
1085998496 11:81951481-81951503 CAAGCAGGGGATACGTGACTGGG - Intergenic
1086973810 11:93110608-93110630 CAAGCAGGGGGTATGTGACTGGG + Intergenic
1087394779 11:97583818-97583840 CAAGCAGGGGGTATGTGACTGGG + Intergenic
1087894443 11:103572293-103572315 CAAGCAGGGGATATGTGACTGGG - Intergenic
1089648036 11:119892955-119892977 CAGGCAGGGGCGAGGAGGCTCGG + Intergenic
1091381417 12:64198-64220 CAAGCAGGGGGTACGTGACTGGG - Intergenic
1091770159 12:3146191-3146213 CCATCAGGGGAGTGGTGACTAGG + Intronic
1095897389 12:47293491-47293513 CAAGCAGGGGGTACGTGACTGGG - Intergenic
1097421613 12:59387854-59387876 CAAGCAGGGGGTATGTGACTGGG - Intergenic
1098248032 12:68540480-68540502 CAAGCAGGGGGTATGTGACTGGG - Intergenic
1098248851 12:68547769-68547791 CAAGCAGGGGGTATGTGACTGGG - Intergenic
1099284287 12:80696604-80696626 TACTCAGGAGCAAGGTGACTAGG + Intergenic
1100522468 12:95388526-95388548 CAAGCAGGGGGTACGTGACTGGG - Intergenic
1100541460 12:95561327-95561349 CAAGCAGGGGGTACGTGACTGGG + Intergenic
1104764208 12:131315976-131315998 CAATCAGGTGCAAGGAGATTTGG - Intergenic
1105845043 13:24286732-24286754 CATACAGGGGACAGGTGACTTGG - Intronic
1106640305 13:31577658-31577680 CAAGCAGGGGGTACGTGACTGGG - Intergenic
1106642748 13:31601407-31601429 CAAGCAGGGGGTACGTGACTGGG + Intergenic
1106880447 13:34123329-34123351 CAAGCAGGGGGTACGTGACTGGG - Intergenic
1107016845 13:35714480-35714502 GTGTCAGGGGCTAGGTGACTGGG + Intergenic
1107073261 13:36294763-36294785 CAAGCAGGGGGTACGTGACTGGG + Intronic
1109802333 13:67397505-67397527 CAAGCAGGGGGTATGTGACTGGG - Intergenic
1111052232 13:82899897-82899919 CAAGCAGGGGGTATGTGACTGGG + Intergenic
1111111514 13:83716045-83716067 CAAGCAGGGGGTACGTGACTGGG - Intergenic
1112405741 13:99118631-99118653 CAAGCAGGGGGTACGTGACTGGG + Intergenic
1112939836 13:104848011-104848033 CACTCAGGGGCGAGGGGGCAGGG + Intergenic
1113205453 13:107910995-107911017 CAAGCAGGGGGTACGTGACTAGG - Intergenic
1122242023 14:100375529-100375551 CAATCAGGGGTGGGTTGCCTGGG + Intronic
1124027713 15:25982169-25982191 CAAGCAGGGGGCACGTGACTGGG + Intergenic
1125609372 15:40960383-40960405 CAAGCAGGAGGGAGGAGACTGGG + Intergenic
1125981150 15:44002599-44002621 CAAGCAGGGGGTATGTGACTGGG + Intronic
1126533099 15:49732235-49732257 CAAGCAGGGGGTAAGTGACTGGG + Intergenic
1127505970 15:59598184-59598206 CAACCAGGGGAGAAGAGACTGGG - Intronic
1128013048 15:64316844-64316866 CAAGCAGGGGGTACGTGACTGGG - Intronic
1130612613 15:85375164-85375186 CAATCAGTAGCTATGTGACTTGG + Intergenic
1131458889 15:92604657-92604679 CAAGCAGGGGGTATGTGACTGGG + Intergenic
1132880621 16:2160293-2160315 CCTTCAGGGGCGAGGTGCGTGGG - Intronic
1136467227 16:30453083-30453105 CAAGCAGGGGGTATGTGACTGGG + Intergenic
1136484046 16:30559715-30559737 CAAGCAGGGGATATGTGACTGGG + Intergenic
1137041244 16:35614826-35614848 CAAGCAGGGGGTATGTGACTGGG + Intergenic
1138208266 16:55141414-55141436 CATTCAGAGGCCAGGTGTCTAGG + Intergenic
1138414632 16:56864675-56864697 CAAGCAGGGGGTACGTGACTGGG - Intergenic
1138713670 16:58997613-58997635 CAGTCAGGGCAGAGGGGACTTGG + Intergenic
1140548661 16:75838426-75838448 CAAACAGTGGTGATGTGACTTGG + Intergenic
1141354855 16:83335775-83335797 CAAGCAGGGGGTACGTGACTGGG - Intronic
1142435846 16:90056711-90056733 CAAGCAGGGGGTAGGTGACAGGG + Intronic
1142830821 17:2547798-2547820 CAAGCAGGGGGTACGTGACTGGG - Intergenic
1142910706 17:3088617-3088639 CAAGCAGGGGGTACGTGACTGGG + Intergenic
1143412361 17:6717973-6717995 CAAGCAGGGGGTATGTGACTGGG - Intergenic
1143414821 17:6738629-6738651 CAAGCAGGGGGTATGTGACTGGG + Intergenic
1143618667 17:8068737-8068759 CAAGCAGGGGGTATGTGACTGGG + Intergenic
1144306726 17:13975136-13975158 CAAGCAGGGGGTATGTGACTCGG + Intergenic
1144586404 17:16490524-16490546 CAAGCAGAGACGAGGGGACTTGG - Intronic
1145217807 17:21065426-21065448 CAAGCAGGGGGTACGTGACTGGG + Intergenic
1145953249 17:28836608-28836630 CAAGCAGGGGGTACGTGACTGGG + Intronic
1145978648 17:28998596-28998618 AAATCAGTGGGGTGGTGACTGGG + Intronic
1146753443 17:35403982-35404004 CAAACAGGGGGTACGTGACTCGG + Intergenic
1147450114 17:40499249-40499271 CAAGCAGGGGGTACGTGACTGGG - Intronic
1147732036 17:42610030-42610052 CAATCAGGAGCCGGGGGACTGGG - Intronic
1147810638 17:43167424-43167446 CAAGCAGGGGGTACGTGACTGGG + Intergenic
1148828505 17:50412876-50412898 CAAGCAGGGGGTATGTGACTGGG + Intergenic
1148829333 17:50420194-50420216 CAAGCAGGGGGTACGTGACTGGG + Intergenic
1148915971 17:50979082-50979104 CAATAAGGGGCCAGGTGCATTGG + Intronic
1149320165 17:55474023-55474045 CAAGCAGGGGATATGTGACTGGG - Intergenic
1151504869 17:74521252-74521274 GACTCAGGGGCGAGGGGACATGG - Exonic
1151510820 17:74558726-74558748 CAAGCAGGGGGTACGTGACTAGG - Intergenic
1152122091 17:78425097-78425119 AAAGCAGAGGCCAGGTGACTGGG + Intronic
1152453336 17:80397576-80397598 CAAGCAGGGGGTACGTGACTGGG - Exonic
1152455413 17:80413310-80413332 CAAGCAGGGGGTACGTGACTGGG - Intergenic
1153830838 18:8921155-8921177 CAAGCAGGGGGTATGTGACTGGG - Intergenic
1154014416 18:10603923-10603945 CAAGCAGGGGGTACGTGACTGGG + Intergenic
1154014779 18:10606568-10606590 CAAGCAGGGGGTACGTGACTGGG - Intergenic
1154190709 18:12229010-12229032 CAAGCAGGGGGTACGTGACTGGG + Intergenic
1154230557 18:12552697-12552719 CAAGCAGGGGGTACGTGACTGGG - Intronic
1156289704 18:35735592-35735614 CAAGCAGGGGGTACGTGACTGGG - Intergenic
1158196020 18:54885858-54885880 CAATCATGGGGAAGGTGACGGGG + Intronic
1158292561 18:55957770-55957792 CAAGCAGGGGGTACGTGACTGGG - Intergenic
1158807003 18:60985756-60985778 CAAGCAGGGGGTACGTGACTAGG - Intergenic
1158829934 18:61265495-61265517 CAAGCAGGGGGTACGTGACTGGG - Intergenic
1159931171 18:74314774-74314796 CAATAAGGAGAGAGGTGGCTTGG - Intergenic
1160696591 19:488002-488024 CAAGCAGGGGGTACGTGACTGGG - Intergenic
1161830662 19:6601793-6601815 CAAGCAGGGCCTACGTGACTGGG - Intronic
1162647559 19:12060996-12061018 CAAGCAGGGGGTACGTGACTGGG - Intergenic
1163629937 19:18413110-18413132 CACTCAGGGGCGAGGAGCGTGGG + Intergenic
1164121383 19:22268569-22268591 CAAGCAGGGGGTACGTGACTGGG + Intergenic
1164121929 19:22273342-22273364 CAAGCAGGGGGTATGTGACTGGG + Intergenic
1164264313 19:23598541-23598563 CAAGCAGGGGGTAGATGACTGGG + Intronic
1165322178 19:35092598-35092620 CAAGCAGGGGGTATGTGACTGGG + Intergenic
1166497432 19:43314265-43314287 CAAGCAGGGGGTATGTGACTGGG - Intergenic
1168219940 19:54953360-54953382 CAAGCAGGGGGTACGTGACTGGG + Intronic
925372279 2:3355374-3355396 CAATCAGGATTGAGATGACTTGG - Intronic
925799683 2:7585831-7585853 CAAGCAGGGGGTACGTGACTGGG + Intergenic
926490985 2:13526143-13526165 CAAGCAGGGGGTACGTGACTGGG + Intergenic
926731296 2:16037701-16037723 AAAACAGGGGCCTGGTGACTGGG - Intergenic
930166260 2:48206490-48206512 CAAGCAGGGGGTACGTGACTGGG + Intergenic
930415570 2:51086485-51086507 CAAGCAGGGGGTACGTGACTGGG - Intergenic
932544645 2:72695078-72695100 CAACCAGGGGAGAGGTTACAGGG + Intronic
932596420 2:73096332-73096354 CACTCAGGGGAGAGCTGACCTGG + Intronic
933055642 2:77660435-77660457 CAAGCAGGGGGTATGTGACTTGG - Intergenic
934650991 2:96091342-96091364 GAGGCAGGGGCGAGGTGACCAGG + Intergenic
935721803 2:105986088-105986110 CAAGCAGGGGGTAAGTGACTGGG + Intergenic
936477264 2:112850109-112850131 CAAGCAGGGGGTATGTGACTGGG - Intergenic
938127190 2:128683055-128683077 CAAGCAGGGGGTACGTGACTGGG - Intergenic
938256516 2:129863662-129863684 CAAGCAGGGAGGAGGTGATTGGG - Intergenic
938702793 2:133894190-133894212 CAAGCAGGGGGTACGTGACTAGG - Intergenic
938703290 2:133898385-133898407 CAAGCAGGGGGTACGTGACTGGG - Intergenic
939809523 2:146813785-146813807 CAAGCAGGGGATACGTGACTGGG - Intergenic
939845186 2:147235074-147235096 CAGTCAGGGGCTAGGTGCTTAGG + Intergenic
941539703 2:166767022-166767044 CAAGCAGGGGGTACGTGACTAGG - Intergenic
942173444 2:173309022-173309044 CAAGCAGGGGGTACGTGACTGGG - Intergenic
942930787 2:181490027-181490049 CAAGCAGGGGGTACGTGACTGGG + Intronic
943196973 2:184765554-184765576 CAAGCAGGGGTTACGTGACTGGG - Intronic
943407744 2:187510742-187510764 CAAGCAGGGGGTACGTGACTGGG - Intronic
943450882 2:188040420-188040442 CAAGCAGGGGGTACGTGACTGGG - Intergenic
947919534 2:233857147-233857169 CAAGCAGGGGGTAAGTGACTGGG + Intergenic
948373725 2:237506551-237506573 CAAGCAGGGGGTACGTGACTGGG + Intronic
1173814175 20:45974409-45974431 CAAACTTGGGAGAGGTGACTTGG - Intergenic
1174095358 20:48084779-48084801 CAAGCAGGGGGTACGTGACTGGG + Intergenic
1175514213 20:59558615-59558637 CAAGCAGGGGGTACGTGACTGGG + Intergenic
1175591081 20:60192790-60192812 CACATGGGGGCGAGGTGACTTGG + Intergenic
1176283792 20:64330636-64330658 CAAGCAGGGGGTACGTGACTGGG + Intergenic
1176286768 21:5022722-5022744 CGGTCAGGGGCGGGGTGGCTCGG + Intronic
1177011746 21:15738923-15738945 CAAGCAGGGGGTATGTGACTGGG - Intronic
1178447524 21:32659615-32659637 CAAGCAGGGGGTATGTGACTGGG - Intronic
1179087094 21:38227526-38227548 CAATCAGGAGCAAGGTGGCTGGG + Intronic
1179192430 21:39135017-39135039 CAAGCAGGGGGTACGTGACTGGG + Intergenic
1179870413 21:44240753-44240775 CGGTCAGGGGCGGGGTGGCTCGG - Intronic
1180752971 22:18137933-18137955 CAAGCAGGGGGTACGTGACTGGG - Intronic
1185386429 22:50533512-50533534 CAAGCAGGGGGTACGTGACTGGG + Intergenic
951248086 3:20364150-20364172 CAAGCAGGGGGTATGTGACTGGG + Intergenic
951329841 3:21353716-21353738 CAAGCAGGGGGTACGTGACTGGG - Intergenic
951698973 3:25475673-25475695 CCATGAGAGGAGAGGTGACTTGG - Intronic
953575114 3:44106996-44107018 CAAGCAGGGGCCACGTGTCTGGG + Intergenic
953745529 3:45571079-45571101 CAAGCAGGGGGTACGTGACTGGG - Intronic
954122324 3:48506686-48506708 CAAGCAGGGGGTACGTGACTGGG - Intergenic
955380569 3:58434768-58434790 CAAGCAGGGGGTATGTGACTAGG + Intergenic
958532180 3:95348266-95348288 CAAGCAGGGGGTATGTGACTGGG - Intergenic
962096142 3:132295224-132295246 CAAGCAGGGGGTACGTGACTGGG - Intergenic
962096296 3:132296258-132296280 CAAGCAGGGGGTATGTGACTGGG + Intergenic
962097090 3:132303407-132303429 CAAGCAGGGGTTACGTGACTGGG + Intergenic
964077867 3:152713555-152713577 CAAGCAGGGGGTACGTGACTGGG + Intergenic
964666733 3:159182634-159182656 CAAGCAGGGGGTACGTGACTGGG + Intronic
964932540 3:162044710-162044732 CAAGCAGGGGGTACGTGACTGGG + Intergenic
968112158 3:196057331-196057353 CAAGCAGGGGGTACGTGACTGGG - Intronic
970737623 4:19193317-19193339 CAAGCAGGGGGTACGTGACTGGG + Intergenic
971211416 4:24621453-24621475 CAAGCAGGGGGTATGTGACTGGG + Intergenic
971385955 4:26140638-26140660 CAATCAGAGGCAATGTGATTTGG - Intergenic
971752048 4:30662838-30662860 CAAGCAGGGGGTATGTGACTGGG + Intergenic
972216670 4:36905978-36906000 CAAGCAGCGGGTAGGTGACTGGG - Intergenic
972784272 4:42312410-42312432 CAAGCAGGGGGTATGTGACTGGG + Intergenic
972933219 4:44100873-44100895 CAAGCAGGGGGTACGTGACTGGG + Intergenic
973262729 4:48181120-48181142 CAATCAGGTGCGAGGAGGCAGGG + Intronic
977610358 4:99024201-99024223 CAAGCAGGGGGTACGTGACTGGG - Intronic
977972003 4:103223873-103223895 CAAGCAGGGGGTACGTGACTGGG - Intergenic
977972852 4:103231243-103231265 CAAGCAGGGGGTATGTGACTGGG - Intergenic
978564836 4:110070786-110070808 CAATCATGGTGGAGGCGACTGGG - Intronic
979924675 4:126546449-126546471 CAAGCAGGGGGTATGTGACTGGG - Intergenic
980117240 4:128691276-128691298 CAAGCAGGGGGTACGTGACTGGG - Intergenic
980780620 4:137486834-137486856 CAAGCAGGGGGTACGTGACTGGG - Intergenic
982663024 4:158228940-158228962 CAAGCAGGGGGTAGTTGACTGGG + Intronic
983114310 4:163793793-163793815 CAAGCAGGGGGTACGTGACTGGG - Intronic
983264371 4:165492632-165492654 CAAGCAGGGGGTACGTGACTGGG + Intronic
983768010 4:171511664-171511686 CAAGCAGGGGGTACGTGACTGGG + Intergenic
983877967 4:172898999-172899021 CAAGCAGTGGCTATGTGACTGGG - Intronic
984762946 4:183377998-183378020 CAAGCAGGGGGTACGTGACTGGG + Intergenic
984934776 4:184880606-184880628 CACACAGGGATGAGGTGACTGGG - Intergenic
987208940 5:15658691-15658713 CAAGCAGGGGGTATGTGACTGGG + Intronic
988938266 5:36113276-36113298 CAAGCAGGGGGTACGTGACTGGG - Intronic
991675698 5:69088000-69088022 CAAGCAGGGGGTACGTGACTGGG + Intergenic
993964585 5:94345906-94345928 CAAGCAGGGGGTACGTGACTGGG + Intronic
995874469 5:116776107-116776129 CAAGCAGGGGTTACGTGACTAGG + Intergenic
996040230 5:118800998-118801020 CAAGCAGGGGGTACGTGACTGGG - Intergenic
999397691 5:151240541-151240563 CAAGCAGGGGGTACGTGACTGGG + Intronic
1000760511 5:165218024-165218046 CAAGCAGTGGGTAGGTGACTGGG + Intergenic
1000934684 5:167293505-167293527 CAATCAGGGGCCAGGTGCGGTGG - Intronic
1001616844 5:173049498-173049520 CAAGCTGGGGCGAGGTGACCGGG + Intergenic
1002999482 6:2317834-2317856 CAAGCAGGGGGTATGTGACTGGG + Intergenic
1003272607 6:4620686-4620708 CAAGCAGGGGGTACGTGACTGGG + Intergenic
1005833894 6:29692992-29693014 CAAGCAGGGGTTATGTGACTAGG + Intergenic
1008122575 6:47635007-47635029 CAAACAGGGGGTACGTGACTGGG - Intergenic
1011941397 6:92847557-92847579 CAAGCAGGGGGTACGTGACTGGG - Intergenic
1013997159 6:116322116-116322138 CAAGCAGGGGGTACGTGACTGGG + Intronic
1013997560 6:116325939-116325961 CAAGCAGGGGGTATGTGACTGGG + Intronic
1014546424 6:122741703-122741725 CAAGCAGGGGGTACGTGACTGGG + Intergenic
1016026194 6:139289318-139289340 CAAGCAGGGGGTACGTGACTGGG - Intronic
1018469657 6:164084170-164084192 CACTCAGGTGCAGGGTGACTGGG - Intergenic
1019124556 6:169829720-169829742 CAGGCAGGGCCGAGGTGGCTTGG + Intergenic
1019444566 7:1064697-1064719 CAGTCTGGGGCCAGGTGACTCGG - Intronic
1019507724 7:1401256-1401278 CAGGCAGGGGCGAGGGGACGGGG - Intergenic
1020135189 7:5583743-5583765 CAAGCAGGGGGTACGTGACTGGG - Intergenic
1020437715 7:8183552-8183574 CAATCTGGGGCTAGAAGACTTGG + Intronic
1021471532 7:21008194-21008216 CAAGCAGGGGGTACGTGACTGGG - Intergenic
1023093119 7:36634426-36634448 CAAGCAGGGGGTACGTGACTGGG - Intronic
1023799892 7:43824763-43824785 CAAGCAGGGGGTACGTGACTTGG - Intergenic
1024718993 7:52113530-52113552 CAAGCAGGGGGCACGTGACTGGG - Intergenic
1024952628 7:54880434-54880456 CAAGCAGGGGGTATGTGACTGGG + Intergenic
1025710657 7:63905251-63905273 CAAGCAGGGGGTACGTGACTGGG + Intergenic
1026119599 7:67525249-67525271 CAAGCAGGGGGTACGTGACTGGG - Intergenic
1027641032 7:80734155-80734177 CCATCAGGGGCCAAGGGACTTGG + Intergenic
1028127540 7:87131032-87131054 CAATCTGGAGGGAGATGACTAGG - Intergenic
1028478294 7:91275565-91275587 AAATCAGAGAAGAGGTGACTAGG - Intergenic
1029486644 7:100846976-100846998 CAAGCAGGGGGTACGTGACTGGG - Intronic
1029602307 7:101574770-101574792 CAAGCAGGGGGTACGTGACTAGG + Intergenic
1029957245 7:104652823-104652845 CAATCTGTGCAGAGGTGACTGGG + Intronic
1031300499 7:120057279-120057301 CTATCAGGAGCAAGGTGGCTGGG + Intergenic
1031916789 7:127570907-127570929 CAAGCAGGGGGTACGTGACTGGG - Intergenic
1032772539 7:135073719-135073741 CAAGCAGGGGGTACGTGACTGGG + Intronic
1033023659 7:137752670-137752692 CAAGCAGGGGTTATGTGACTGGG - Intronic
1034824572 7:154250092-154250114 CAAGCAGGGGGTATGTGACTGGG - Intronic
1034978255 7:155460225-155460247 CAATGCCGGGCGAGGAGACTCGG + Intronic
1036193903 8:6697516-6697538 CAAGCAGGGGGTACGTGACTGGG - Intergenic
1038089291 8:24235744-24235766 CAAGCAGGGGGTACGTGACTGGG - Intergenic
1038547125 8:28434246-28434268 CAATCAGGGGCCAGGTGCAGTGG - Intronic
1039462064 8:37753335-37753357 CAATCAGGGGCGAAGTTCCAGGG + Intronic
1039685243 8:39794686-39794708 CAAGCAGGGGGTATGTGACTGGG - Intronic
1039876536 8:41591128-41591150 CAAGCAGGGGGTACGTGACTGGG + Intronic
1040986158 8:53296409-53296431 CAAGCAGGGGGTACGTGACTAGG + Intergenic
1041227573 8:55715840-55715862 CAAGCAGGGGGTAGGTGACTGGG - Intronic
1041515054 8:58691110-58691132 CAAGCAGGGGGTACGTGACTGGG - Intergenic
1041515921 8:58698663-58698685 CAAGCAGGGGGTATGTGACTGGG - Intergenic
1042327269 8:67541506-67541528 CAAGCAGGGGGTATGTGACTGGG - Intronic
1042489318 8:69380442-69380464 CAAGCAGGGGGTACGTGACTGGG + Intergenic
1042979397 8:74508437-74508459 CAAGCAGGGGGTATGTGACTGGG + Intergenic
1043853106 8:85236521-85236543 CTATCATTGGAGAGGTGACTGGG + Intronic
1044529022 8:93287117-93287139 CAATCAGGTGACAGGTGAGTGGG - Intergenic
1045799606 8:106087215-106087237 CAAGCAGGGGGGACGTGACAGGG + Intergenic
1047285738 8:123485815-123485837 CAAGCAGGGGGTACGTGACTGGG - Intergenic
1047349795 8:124062779-124062801 CACCCAGGGGTGAGATGACTAGG + Intronic
1049634519 8:143680179-143680201 CAAGCAGGGGGTACGTGACTGGG - Intergenic
1055443773 9:76362809-76362831 CAAGCAGGGGGTACGTGACTGGG - Intergenic
1055706290 9:79008557-79008579 CAAGCAGGGGGTATGTGACTGGG - Intergenic
1056507129 9:87268089-87268111 CAGTCAGGGGCCAGGTGGCTAGG - Intergenic
1056620129 9:88205643-88205665 CAAGCAGGGGGTATGTGACTGGG + Intergenic
1056656419 9:88513297-88513319 CAAGCAGGGGGTACGTGACTGGG + Intergenic
1058947383 9:109870363-109870385 CATCCAGGGGCGAGGCCACTAGG - Intronic
1061072887 9:128322608-128322630 CTTTCTGGGGCGAGGTGACATGG + Exonic
1061851522 9:133418653-133418675 CAAGCAGGGGGTACGTGACTGGG + Intronic
1185835173 X:3339221-3339243 CAAGCAGGGGCAAGATGACAGGG - Intronic
1186020342 X:5247429-5247451 CAAGCAGGGGGTACGTGACTGGG - Intergenic
1186877302 X:13829021-13829043 CAATAAGGCCCCAGGTGACTAGG + Intronic
1187287903 X:17923779-17923801 CAATGTGGGGCCATGTGACTAGG - Intergenic
1187491473 X:19755890-19755912 CAAGCAGGGGGTACGTGACTGGG - Intronic
1190269833 X:48853962-48853984 CAAGCAGGGGGTACGTGACTGGG - Intergenic
1190770845 X:53512927-53512949 CAAGCAGGGGGTATGTGACTGGG - Intergenic
1191917500 X:66218739-66218761 CAAGCAGGGGGTACGTGACTGGG + Intronic
1193145244 X:78069236-78069258 CAAGCATGGGGTAGGTGACTAGG + Intronic
1193479581 X:82010779-82010801 CTATCAGTGGCGAGGTGAGTGGG + Intergenic
1193773763 X:85619454-85619476 CAAGTGGGGGCGAGGTGTCTGGG - Intergenic
1193774374 X:85623865-85623887 CAAGCAGGGGATACGTGACTGGG - Intergenic
1195336366 X:103858765-103858787 CAAGCAGGGGGTACGTGACTGGG - Intergenic
1196422559 X:115537920-115537942 CAAGCAGGGGGTACGTGACTGGG + Intergenic
1196423417 X:115545383-115545405 CAAGCAGGGGGTACGTGACTGGG + Intergenic
1196869747 X:120101481-120101503 CAAGCAGGGGATATGTGACTGGG - Intergenic
1199736673 X:150692666-150692688 TAATCAGGGGTGAGGTGAGAGGG + Intergenic