ID: 905819709

View in Genome Browser
Species Human (GRCh38)
Location 1:40979961-40979983
Sequence TGACTCGGCGTCCTGCCCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 46
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 42}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905819699_905819709 23 Left 905819699 1:40979915-40979937 CCGCCGCCGCGGTGACGGACGTC 0: 1
1: 0
2: 0
3: 2
4: 37
Right 905819709 1:40979961-40979983 TGACTCGGCGTCCTGCCCAATGG 0: 1
1: 0
2: 0
3: 3
4: 42
905819697_905819709 25 Left 905819697 1:40979913-40979935 CCCCGCCGCCGCGGTGACGGACG 0: 1
1: 0
2: 0
3: 2
4: 49
Right 905819709 1:40979961-40979983 TGACTCGGCGTCCTGCCCAATGG 0: 1
1: 0
2: 0
3: 3
4: 42
905819706_905819709 -3 Left 905819706 1:40979941-40979963 CCTACCAATCAGGGGCGAGGTGA 0: 1
1: 0
2: 0
3: 1
4: 60
Right 905819709 1:40979961-40979983 TGACTCGGCGTCCTGCCCAATGG 0: 1
1: 0
2: 0
3: 3
4: 42
905819707_905819709 -7 Left 905819707 1:40979945-40979967 CCAATCAGGGGCGAGGTGACTCG 0: 1
1: 0
2: 0
3: 4
4: 39
Right 905819709 1:40979961-40979983 TGACTCGGCGTCCTGCCCAATGG 0: 1
1: 0
2: 0
3: 3
4: 42
905819698_905819709 24 Left 905819698 1:40979914-40979936 CCCGCCGCCGCGGTGACGGACGT 0: 1
1: 0
2: 0
3: 2
4: 22
Right 905819709 1:40979961-40979983 TGACTCGGCGTCCTGCCCAATGG 0: 1
1: 0
2: 0
3: 3
4: 42
905819701_905819709 17 Left 905819701 1:40979921-40979943 CCGCGGTGACGGACGTCGCTCCT 0: 1
1: 0
2: 0
3: 0
4: 10
Right 905819709 1:40979961-40979983 TGACTCGGCGTCCTGCCCAATGG 0: 1
1: 0
2: 0
3: 3
4: 42
905819700_905819709 20 Left 905819700 1:40979918-40979940 CCGCCGCGGTGACGGACGTCGCT 0: 1
1: 0
2: 0
3: 0
4: 10
Right 905819709 1:40979961-40979983 TGACTCGGCGTCCTGCCCAATGG 0: 1
1: 0
2: 0
3: 3
4: 42

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905819709 Original CRISPR TGACTCGGCGTCCTGCCCAA TGG Intronic
902670077 1:17967051-17967073 GGACTCAGAGTCCTGCCCAGGGG - Intergenic
903562392 1:24237480-24237502 TGACTTGGCTTCCTGCCCCTGGG - Intergenic
905018034 1:34791028-34791050 TAACTCGGCCTCCTCCCCAGAGG - Intronic
905819709 1:40979961-40979983 TGACTCGGCGTCCTGCCCAATGG + Intronic
915524931 1:156469965-156469987 TGTCTTGGCCTCATGCCCAAGGG + Intronic
918177377 1:182057842-182057864 TGACCCGGTGGCCTGTCCAAGGG - Exonic
922506620 1:226129876-226129898 TCACTCGGCTTCATGCACAATGG + Intergenic
923119575 1:230978338-230978360 CGACTCGCCGCCCTGCCCAAAGG + Intronic
1063188466 10:3671059-3671081 TGACTTGGCGTCCTGCACTAGGG - Intergenic
1085618997 11:78023200-78023222 TGGCTCGTCATCCTGCCCACTGG + Exonic
1090372196 11:126264147-126264169 GGAATGGGCGTCCTGCACAAAGG - Intronic
1103246075 12:119458645-119458667 TGAATCGGCCTCCCTCCCAAGGG - Intronic
1108234751 13:48391863-48391885 TGCCTCGGCCTCCTCCCAAAGGG + Intronic
1112039769 13:95535306-95535328 TGACTGGTCTTCCTGCCCCAGGG - Intronic
1122167880 14:99843810-99843832 TGACCCAGCGTCCTACACAATGG + Intronic
1122694353 14:103545577-103545599 TGCCTCAGCCTCCAGCCCAATGG + Intergenic
1123783579 15:23647485-23647507 TGACCCAGCCTCCTGCCCTAGGG - Exonic
1124198144 15:27651659-27651681 TGCCTTGGCCTCCTCCCCAAAGG - Intergenic
1132594102 16:740489-740511 TGACAAGGCGTCCTGCGCAGGGG + Intronic
1133095279 16:3440859-3440881 TGACTCTGCACCCTGCCCAGAGG - Exonic
1153516888 18:5912006-5912028 TGCACCGGCTTCCTGCCCAATGG + Intergenic
1153978103 18:10287165-10287187 TCACTCGGCATCTTGGCCAAGGG + Intergenic
1158987192 18:62830123-62830145 TGACTTGGCGTCTTGTCCATCGG - Exonic
1165802505 19:38561685-38561707 TGACCCTGCTTCATGCCCAAGGG - Intronic
1166377646 19:42336647-42336669 TGACTCAGGGTCCTGCCCACAGG + Intronic
1167385129 19:49158357-49158379 GGACTCGGGGACCTTCCCAAGGG + Intronic
926172598 2:10561782-10561804 TCCCTGGGCATCCTGCCCAATGG - Intergenic
929412243 2:41710054-41710076 TGTTTCGGTGTCCTGCTCAAAGG - Intergenic
948078332 2:235184552-235184574 TGGCTTGGCGTCCTTCCCATAGG - Intergenic
1172271974 20:33659936-33659958 GGGCTCGGCGTCCTGCCCGCCGG + Exonic
1176271968 20:64239991-64240013 TGCCTCTGGGTCCTGCCCTAGGG + Intronic
1178777463 21:35565836-35565858 ACACTCTGCCTCCTGCCCAAAGG + Intronic
1181750503 22:24985919-24985941 TGACTCAGCTTCCTCCCGAAGGG - Intronic
953882925 3:46700956-46700978 TGGCTTGGCTTCCTGCCCAGAGG - Intergenic
956894720 3:73648406-73648428 TGAATCTGCCTCCTTCCCAAAGG + Intergenic
963900457 3:150727983-150728005 TGACTCAGCGTTCTCCCCTAAGG - Intergenic
975895157 4:79079993-79080015 TGACACGGGGACCTACCCAAAGG - Intergenic
1017443189 6:154483611-154483633 TGACTCTGTGTCCTGCCTAGGGG - Intronic
1019996110 7:4725459-4725481 GGACACGGCCTCCTGCCCACAGG + Intronic
1032505459 7:132431226-132431248 TGACTGGGACTCCTGGCCAATGG - Intronic
1033974479 7:147082992-147083014 GGAATCGGCGGCCTTCCCAAAGG + Intronic
1037274459 8:17162821-17162843 TGAGTTGGCTTCCTGGCCAATGG + Intronic
1040804078 8:51374911-51374933 TGACTCTGCCTCCTGCCTATGGG - Intronic
1046645451 8:116781140-116781162 TGACTCGGTGTCCTCCCTACTGG + Intronic
1059401045 9:114070905-114070927 TGGCTCGCAGCCCTGCCCAAGGG - Intronic
1059825722 9:118026692-118026714 GGACTCAGCGGCATGCCCAAAGG - Intergenic