ID: 905819710

View in Genome Browser
Species Human (GRCh38)
Location 1:40979962-40979984
Sequence GACTCGGCGTCCTGCCCAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 38
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 34}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905819697_905819710 26 Left 905819697 1:40979913-40979935 CCCCGCCGCCGCGGTGACGGACG 0: 1
1: 0
2: 0
3: 2
4: 49
Right 905819710 1:40979962-40979984 GACTCGGCGTCCTGCCCAATGGG 0: 1
1: 0
2: 0
3: 3
4: 34
905819701_905819710 18 Left 905819701 1:40979921-40979943 CCGCGGTGACGGACGTCGCTCCT 0: 1
1: 0
2: 0
3: 0
4: 10
Right 905819710 1:40979962-40979984 GACTCGGCGTCCTGCCCAATGGG 0: 1
1: 0
2: 0
3: 3
4: 34
905819700_905819710 21 Left 905819700 1:40979918-40979940 CCGCCGCGGTGACGGACGTCGCT 0: 1
1: 0
2: 0
3: 0
4: 10
Right 905819710 1:40979962-40979984 GACTCGGCGTCCTGCCCAATGGG 0: 1
1: 0
2: 0
3: 3
4: 34
905819698_905819710 25 Left 905819698 1:40979914-40979936 CCCGCCGCCGCGGTGACGGACGT 0: 1
1: 0
2: 0
3: 2
4: 22
Right 905819710 1:40979962-40979984 GACTCGGCGTCCTGCCCAATGGG 0: 1
1: 0
2: 0
3: 3
4: 34
905819706_905819710 -2 Left 905819706 1:40979941-40979963 CCTACCAATCAGGGGCGAGGTGA 0: 1
1: 0
2: 0
3: 1
4: 60
Right 905819710 1:40979962-40979984 GACTCGGCGTCCTGCCCAATGGG 0: 1
1: 0
2: 0
3: 3
4: 34
905819707_905819710 -6 Left 905819707 1:40979945-40979967 CCAATCAGGGGCGAGGTGACTCG 0: 1
1: 0
2: 0
3: 4
4: 39
Right 905819710 1:40979962-40979984 GACTCGGCGTCCTGCCCAATGGG 0: 1
1: 0
2: 0
3: 3
4: 34
905819699_905819710 24 Left 905819699 1:40979915-40979937 CCGCCGCCGCGGTGACGGACGTC 0: 1
1: 0
2: 0
3: 2
4: 37
Right 905819710 1:40979962-40979984 GACTCGGCGTCCTGCCCAATGGG 0: 1
1: 0
2: 0
3: 3
4: 34

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905819710 Original CRISPR GACTCGGCGTCCTGCCCAAT GGG Intronic
900421940 1:2559532-2559554 AGCTCGGCGTCCTGCCCATCTGG + Intronic
900605169 1:3520610-3520632 GACTCGGCGGCCAGGGCAATGGG + Intronic
905819710 1:40979962-40979984 GACTCGGCGTCCTGCCCAATGGG + Intronic
911786965 1:101963155-101963177 GGCTCTGAGTCCTGCCCAATAGG - Intronic
915920363 1:159971765-159971787 GACCCTGCGTCCTTCCCAAATGG - Intergenic
922506621 1:226129877-226129899 CACTCGGCTTCATGCACAATGGG + Intergenic
1079013188 11:16846442-16846464 GACTCTGCCTCTTGCCCACTGGG + Intronic
1094525266 12:31227059-31227081 GACCTGGCCTCCTGCCCACTGGG + Intergenic
1095097739 12:38157232-38157254 GCCTCTACGCCCTGCCCAATAGG + Intergenic
1110287465 13:73766296-73766318 GTCTCGGCGTCCAGCCAAACTGG + Intronic
1121075062 14:91060772-91060794 GTCACAGCGTACTGCCCAATGGG - Intronic
1122666332 14:103333309-103333331 GACTCGACGTGATGCCCACTAGG + Intergenic
1130086221 15:80780015-80780037 GTCTCGGTGTCCTGCCGACTGGG + Intronic
1132010157 15:98268133-98268155 GACTTGGCGTCCTGCTAAGTAGG - Intergenic
1132515027 16:362224-362246 GACCCAGAGTCCTGCCCAGTGGG - Intergenic
1148342086 17:46879257-46879279 GACCCGGCCTCCTGCTCAGTGGG - Intronic
1153516889 18:5912007-5912029 GCACCGGCTTCCTGCCCAATGGG + Intergenic
1155835782 18:30582265-30582287 GGCTCGGTCTCCTGCCCACTTGG + Intergenic
1159923716 18:74248134-74248156 GACTAGAGGTCCTGCCCACTCGG - Intergenic
1166377647 19:42336648-42336670 GACTCAGGGTCCTGCCCACAGGG + Intronic
1168137364 19:54360471-54360493 GACCCTGCGTTCTGCCCAGTGGG + Intronic
925050941 2:814832-814854 GACTGGGCTTCCTACCCATTAGG + Intergenic
926172596 2:10561781-10561803 CCCTGGGCATCCTGCCCAATGGG - Intergenic
935570882 2:104659322-104659344 GGCGCGGCGTCCCGCACAATGGG + Intergenic
937916592 2:127102268-127102290 GACTCAGCGTCCAGCCCAGCTGG - Intronic
1172596423 20:36154164-36154186 GACTCGGCGTCCTCCCCCACCGG - Intronic
1183251032 22:36730467-36730489 GACTCGCCATCCTCCCCAACTGG + Intergenic
955687540 3:61561995-61562017 GACTCCGCGCCCTGCCCGATCGG + Exonic
968888583 4:3353000-3353022 GACTCAGTGGCCTGCCCCATCGG - Intronic
985894068 5:2738864-2738886 GCCTCGGCGTCCAGGCCCATTGG - Intergenic
986644230 5:9900870-9900892 GCCTCGGCCTCCTGCTCAAACGG + Intergenic
1006949197 6:37807776-37807798 AGCTCCTCGTCCTGCCCAATGGG + Intergenic
1028198600 7:87934872-87934894 GTCTCTGCGTCCTTCCCAGTTGG + Intronic
1029709747 7:102293100-102293122 GACTCGCCGCCCCGCCTAATGGG - Intronic
1030508629 7:110455824-110455846 GACTCTGCGTCTTGCACCATTGG - Intergenic
1039485237 8:37904682-37904704 GCCTCAGCCTCCTGCCCACTTGG + Intergenic
1046645452 8:116781141-116781163 GACTCGGTGTCCTCCCTACTGGG + Intronic
1062032869 9:134369946-134369968 GAGTCTGCCTCCTGCCCAGTGGG + Intronic