ID: 905822362

View in Genome Browser
Species Human (GRCh38)
Location 1:41003520-41003542
Sequence GGCTCTGGAGCTATTGAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 106}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905822355_905822362 19 Left 905822355 1:41003478-41003500 CCTTGTCCTAAGTGAGGCTTGGG 0: 1
1: 0
2: 1
3: 10
4: 183
Right 905822362 1:41003520-41003542 GGCTCTGGAGCTATTGAAACTGG 0: 1
1: 0
2: 0
3: 13
4: 106
905822357_905822362 13 Left 905822357 1:41003484-41003506 CCTAAGTGAGGCTTGGGCAGTTA 0: 1
1: 0
2: 0
3: 13
4: 151
Right 905822362 1:41003520-41003542 GGCTCTGGAGCTATTGAAACTGG 0: 1
1: 0
2: 0
3: 13
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905822362 Original CRISPR GGCTCTGGAGCTATTGAAAC TGG Intronic