ID: 905823156

View in Genome Browser
Species Human (GRCh38)
Location 1:41009753-41009775
Sequence GGGACCTGGCCAATATGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 111}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905823156_905823164 5 Left 905823156 1:41009753-41009775 CCCTGGCATATTGGCCAGGTCCC 0: 1
1: 0
2: 0
3: 7
4: 111
Right 905823164 1:41009781-41009803 CTGCAGCATCTGAGCTCTGGTGG 0: 1
1: 0
2: 1
3: 18
4: 311
905823156_905823165 26 Left 905823156 1:41009753-41009775 CCCTGGCATATTGGCCAGGTCCC 0: 1
1: 0
2: 0
3: 7
4: 111
Right 905823165 1:41009802-41009824 GGTGCTGACCAGATCACACTTGG 0: 1
1: 0
2: 0
3: 6
4: 103
905823156_905823163 2 Left 905823156 1:41009753-41009775 CCCTGGCATATTGGCCAGGTCCC 0: 1
1: 0
2: 0
3: 7
4: 111
Right 905823163 1:41009778-41009800 TTTCTGCAGCATCTGAGCTCTGG 0: 1
1: 0
2: 1
3: 21
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905823156 Original CRISPR GGGACCTGGCCAATATGCCA GGG (reversed) Intronic
902518997 1:17005257-17005279 GGGACCTGCCTAATGTCCCATGG + Intronic
905823156 1:41009753-41009775 GGGACCTGGCCAATATGCCAGGG - Intronic
905930011 1:41780277-41780299 GGGCCTTGGCCACTCTGCCAAGG + Intronic
906675990 1:47694078-47694100 GGGTCCTTACCAAGATGCCATGG + Intergenic
906946875 1:50301910-50301932 GGCTCCTGGCCTATCTGCCAGGG - Intergenic
907585860 1:55617289-55617311 GGGACTTGGCCAATATGTAAAGG - Intergenic
911804958 1:102194499-102194521 GGGACCTTTCCTATATGCCTAGG - Intergenic
912234792 1:107837970-107837992 GGGACCTGGCAAATAATTCATGG + Intronic
914007752 1:143747734-143747756 GGGAGCTGACCAAATTGCCAAGG + Intergenic
915599592 1:156913924-156913946 GGGACCTGCCCAGCTTGCCAGGG + Exonic
919620826 1:199862846-199862868 GGGACCTGGCCATTCTGCTGTGG - Intergenic
922698025 1:227741417-227741439 TGGACCTGGCCCATGAGCCAAGG - Intronic
923134762 1:231108189-231108211 GGGACCTTGCCTACATGCTAAGG + Intergenic
923209035 1:231786739-231786761 GGGACCTAGCCTGTATGCCCAGG + Intronic
923768769 1:236918295-236918317 CCGACCTGGCCAACATGGCAAGG - Intergenic
1065071419 10:22028224-22028246 GGGACCTGGACAATAGTTCAAGG - Intergenic
1069156603 10:65037623-65037645 GGGACCTGCCCTATCTGCCTAGG - Intergenic
1075481995 10:122789851-122789873 GTGTCCTGGCAAATGTGCCATGG - Intergenic
1079391424 11:20025124-20025146 GTGACCTGCCCAAGGTGCCAGGG - Intronic
1080417926 11:32086927-32086949 GTGACCTGGCAACTCTGCCAAGG + Intronic
1081807701 11:45899476-45899498 GGGATCTGTCCAAGGTGCCAGGG + Intronic
1082026763 11:47578450-47578472 AGGACCTGGCCACTAGGCCGGGG - Intronic
1084885871 11:72206509-72206531 TGGGCCTGGCCAAAATGCAACGG + Intergenic
1085428131 11:76422962-76422984 GGGACAGGTCCAACATGCCAGGG + Intergenic
1085507787 11:77069988-77070010 GGGACCTGGCCCCTTTGCCTTGG - Intronic
1090779268 11:129992503-129992525 GGGTCCTGGCCACTTTGCCTAGG - Intronic
1092740338 12:11622529-11622551 GGTACCAGGCCAATATTTCAAGG - Intergenic
1097081182 12:56432340-56432362 GGGACTCGGGCAATAGGCCAGGG + Intronic
1097934769 12:65234145-65234167 TGGATCTGGCCCATAAGCCATGG - Intronic
1102166471 12:110810740-110810762 GAGACATGGCCAACATGTCAAGG - Intergenic
1104405720 12:128515064-128515086 GGAACTTGTCCAATATGCTAGGG - Intronic
1106316961 13:28602826-28602848 GGGACCTGAACAATATATCATGG - Intergenic
1108044621 13:46372004-46372026 GGGAGGTGGCCAAAATCCCAGGG + Exonic
1109430574 13:62229072-62229094 GATACCTGGCCAATACGACAAGG - Intergenic
1121105707 14:91278126-91278148 GGGACCTGGCCACTTTGCCCCGG - Exonic
1122395672 14:101427785-101427807 GGGACCTGGCCAATATGATGAGG + Intergenic
1124370592 15:29102838-29102860 GGGACCTGGGCAATAGGGAAGGG + Intronic
1125170067 15:36756863-36756885 GGGCCCTGGCTAATTTGACATGG + Intronic
1125794930 15:42397071-42397093 AGGACCAGGCCAACATGACATGG + Intronic
1126063220 15:44804096-44804118 GGGACCTAGCCTATGTGCAAAGG + Intergenic
1129489217 15:75906688-75906710 GGGAGCTGGCCAGTATCCAAAGG + Intronic
1130061624 15:80574551-80574573 GGGAAATGGCCAAGAAGCCAAGG - Intronic
1131889958 15:96962396-96962418 GGGCCCTAGCAAATATACCAAGG - Intergenic
1133507775 16:6429293-6429315 GGGAGCTGGCAAAGATCCCAGGG - Intronic
1134123426 16:11600437-11600459 GGGACCCGGCCCATCTGCCTAGG - Intronic
1140511808 16:75513871-75513893 GGTACCAGGTCAAGATGCCATGG - Intergenic
1144028644 17:11300764-11300786 GGTTCCTGGCCAGTATGCCGGGG - Intronic
1148127878 17:45246137-45246159 GGGACCAGGCAGATATTCCAGGG + Intronic
1151886304 17:76925120-76925142 GGCACGTGGCCCACATGCCAGGG + Intronic
1152251484 17:79214935-79214957 GGCACCAGGCGAAGATGCCAAGG - Intronic
1152475004 17:80512279-80512301 GGGACCTGGACCACCTGCCATGG + Intergenic
1153821702 18:8837632-8837654 GGGACCTGCCCCATCTGCCTAGG + Intergenic
1159609330 18:70508768-70508790 CAGACCTGGCCACAATGCCAAGG - Intergenic
1160615097 18:80120153-80120175 GGGACATGGAGCATATGCCAAGG - Intronic
1160779139 19:870126-870148 GGGCCCTGGGCCATATGCTAAGG + Intronic
1161278817 19:3434149-3434171 GGAACCGGGCCAATATGGGAAGG + Intronic
1164035305 19:21449147-21449169 GGGAACTGCCCCATGTGCCAAGG - Intronic
1166873849 19:45885709-45885731 GCGACCTGCCCAAGATGCCGTGG - Exonic
1168025041 19:53637770-53637792 TGGACCTGACCTATATGCCCAGG - Intergenic
925406443 2:3608529-3608551 TGCACCTGGCCAATTTGGCAAGG - Intronic
928254069 2:29706855-29706877 GGGACTTGGCCAAGGTGGCATGG + Intronic
929652207 2:43691601-43691623 GGGACCTGCCCCATCTGCCTAGG + Intronic
929979276 2:46663743-46663765 GGTACCTGGCCAGGATGCCAGGG + Intergenic
931102309 2:59015756-59015778 GGGACCTGCCCTATCTGCCTAGG + Intergenic
932806739 2:74791074-74791096 TGGATTTGGCCCATATGCCATGG + Intergenic
935726197 2:106026158-106026180 GGCAGCTGGCCAATATCCCACGG - Intergenic
938694881 2:133826187-133826209 GGGCCCTGCACACTATGCCAGGG - Intergenic
940033495 2:149289149-149289171 TGGGTCAGGCCAATATGCCAGGG + Intergenic
943820656 2:192315699-192315721 GGGACCTGCCCACTCTGCCCAGG + Intergenic
944039591 2:195338729-195338751 AGGTCCTGGCCAAGAAGCCAAGG + Intergenic
945770414 2:214035338-214035360 GGGACCTGCCCCTTATGCCCAGG + Intronic
946345757 2:219109219-219109241 GGCAACTGGATAATATGCCAGGG + Intronic
946944597 2:224807716-224807738 TGCTCCTGGACAATATGCCAAGG - Exonic
948248156 2:236503770-236503792 GGGACCTGGGCACCATGCCTCGG + Intronic
948701617 2:239764239-239764261 GGGACCTGGGAAGAATGCCAGGG - Intronic
1170418617 20:16170533-16170555 GGCACCTGGCCAATAACACACGG - Intergenic
1172555866 20:35840793-35840815 TGGACCTGGCCACTAACCCAAGG + Intronic
1175916734 20:62429507-62429529 GGTCCCTGGCCAATGAGCCAGGG - Intergenic
1176086290 20:63296980-63297002 GGGGCCTGGCCAACCTCCCAGGG - Intronic
1178275737 21:31235127-31235149 GGGAGCAGGACAATGTGCCAGGG + Intronic
1179277806 21:39907971-39907993 GTGACCTGGCCCAAAGGCCAGGG - Intronic
950499650 3:13355541-13355563 GGGGCCTGGCCAGGCTGCCATGG - Intronic
951888969 3:27551553-27551575 GAGATCTGGCCACTGTGCCAAGG - Intergenic
952134411 3:30400552-30400574 TAGAGCAGGCCAATATGCCAGGG + Intergenic
956774614 3:72554676-72554698 ATGACCTGGCCAATATCCCTTGG + Intergenic
969213575 4:5706805-5706827 GGGACGTGCTCAAGATGCCAAGG + Intronic
971329852 4:25673452-25673474 AGGACCTTGCCAAGATGCAATGG - Intronic
971706865 4:30056309-30056331 GGGTCCTAGACAATAAGCCATGG + Intergenic
979899910 4:126202594-126202616 GGGACCTGCCCCATCTGCCCAGG + Intergenic
985702771 5:1383534-1383556 GGGATCCTGCCAATATCCCAAGG - Intergenic
989306281 5:39960365-39960387 TGGACCTGGGCAATATGTGAAGG + Intergenic
990271498 5:54146448-54146470 GCGCCCTGCCCAATATCCCATGG + Intronic
995011279 5:107259550-107259572 GGGACCAGGGCAAAATGACACGG - Intergenic
1000636067 5:163645096-163645118 GGGACCTGCCCCATCTGCCTAGG - Intergenic
1001590026 5:172858799-172858821 GGGCCCTGCCCAAGATTCCAAGG + Intronic
1001705423 5:173737903-173737925 GGTACCAGGCCAATAGGCTATGG + Intergenic
1003354026 6:5348411-5348433 GGGAAATGGCCAGTAAGCCAGGG - Intronic
1010262307 6:73830942-73830964 GGGGGCTGGACCATATGCCATGG + Intergenic
1012982439 6:105844377-105844399 GGGTCTTGGCCTAGATGCCAGGG - Intergenic
1018199296 6:161380261-161380283 GGGACCTGGCCAGTTCTCCACGG - Intronic
1018230813 6:161673491-161673513 GGTGCCTGGCCAATGTGCCCTGG - Intronic
1022627818 7:32056163-32056185 GGGACCTGGCAAATTTGGCAGGG + Intronic
1022783709 7:33613772-33613794 GTGACCTGGGCAAGAAGCCAAGG + Intergenic
1027250365 7:76395142-76395164 GGGCCCTGGCTAACAGGCCAGGG - Intronic
1029226777 7:99034202-99034224 GGGCCCTGGCCACTCTGCCCGGG + Intronic
1031173994 7:118325611-118325633 GGGACCTGCCCCATCTGCCTAGG + Intergenic
1038024825 8:23578962-23578984 AGGACCTGGCATATAGGCCAAGG + Intergenic
1039341972 8:36660295-36660317 GGGCCATGCCAAATATGCCATGG + Intergenic
1047722106 8:127650583-127650605 GGGATCTTGCCAGTATGCCCAGG - Intergenic
1050814262 9:9789279-9789301 GGGAACTTGCCTATAGGCCAAGG - Intronic
1051841693 9:21405063-21405085 GGGACTGGGCCAAGATGCCAGGG + Intergenic
1056273358 9:84968566-84968588 TGAACCTGACTAATATGCCAAGG + Intronic
1058773308 9:108260048-108260070 GGGAGCTGGCCAAGAGGCCTTGG - Intergenic
1060996209 9:127876033-127876055 GGGACCTATCCACTATGTCAAGG - Intronic
1196602043 X:117612788-117612810 GGGAACTGACCAAGATGCCTAGG + Intergenic
1196706399 X:118721145-118721167 GGATCCTGGCTAAGATGCCAGGG + Intergenic
1196814088 X:119651342-119651364 GGGACTTGGCGAAAGTGCCAAGG - Intronic
1197383083 X:125769561-125769583 GAGACCTGGGCAATTTGCTACGG - Intergenic
1197493957 X:127154163-127154185 GGGACGTGGCCTAAAAGCCATGG - Intergenic