ID: 905823163

View in Genome Browser
Species Human (GRCh38)
Location 1:41009778-41009800
Sequence TTTCTGCAGCATCTGAGCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 215}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905823151_905823163 25 Left 905823151 1:41009730-41009752 CCCGGAGCTTTCTCACGGTGTTT 0: 1
1: 0
2: 1
3: 8
4: 131
Right 905823163 1:41009778-41009800 TTTCTGCAGCATCTGAGCTCTGG 0: 1
1: 0
2: 1
3: 21
4: 215
905823157_905823163 1 Left 905823157 1:41009754-41009776 CCTGGCATATTGGCCAGGTCCCC 0: 1
1: 0
2: 0
3: 6
4: 116
Right 905823163 1:41009778-41009800 TTTCTGCAGCATCTGAGCTCTGG 0: 1
1: 0
2: 1
3: 21
4: 215
905823149_905823163 30 Left 905823149 1:41009725-41009747 CCTTTCCCGGAGCTTTCTCACGG 0: 1
1: 0
2: 0
3: 9
4: 68
Right 905823163 1:41009778-41009800 TTTCTGCAGCATCTGAGCTCTGG 0: 1
1: 0
2: 1
3: 21
4: 215
905823156_905823163 2 Left 905823156 1:41009753-41009775 CCCTGGCATATTGGCCAGGTCCC 0: 1
1: 0
2: 0
3: 7
4: 111
Right 905823163 1:41009778-41009800 TTTCTGCAGCATCTGAGCTCTGG 0: 1
1: 0
2: 1
3: 21
4: 215
905823152_905823163 24 Left 905823152 1:41009731-41009753 CCGGAGCTTTCTCACGGTGTTTC 0: 1
1: 0
2: 0
3: 8
4: 115
Right 905823163 1:41009778-41009800 TTTCTGCAGCATCTGAGCTCTGG 0: 1
1: 0
2: 1
3: 21
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905823163 Original CRISPR TTTCTGCAGCATCTGAGCTC TGG Intronic
900353874 1:2250532-2250554 TGCCAGCAGCAGCTGAGCTCAGG - Intronic
900689201 1:3969677-3969699 TTTCAGCACCATCTGCCCTCTGG + Intergenic
901417427 1:9127527-9127549 CATCTGCAGCATCTGAGCCTCGG + Intronic
901512602 1:9724898-9724920 TCTTTGGAGCAGCTGAGCTCAGG - Exonic
903451547 1:23456907-23456929 GTTCTGCAGCCTCTGGGCTTTGG - Intronic
905823163 1:41009778-41009800 TTTCTGCAGCATCTGAGCTCTGG + Intronic
906155427 1:43611437-43611459 TTTCTGCAGCATGAGAGTTAGGG + Intronic
906528798 1:46511644-46511666 TTTCTGAAGGAACAGAGCTCTGG + Intronic
907208923 1:52801189-52801211 GTACTGCAGCATCTGCTCTCAGG + Intronic
907891920 1:58644813-58644835 TTTCTGCTGCCTCTGAACACTGG - Intergenic
910529618 1:88220933-88220955 TTCCTGCTGCATTTGAGCTAGGG - Intergenic
911697753 1:100911940-100911962 TTTCTACAGTATGTGAGCTCTGG + Intronic
913584818 1:120263993-120264015 TTACTGCAACCTCTGACCTCTGG - Intergenic
915356836 1:155260412-155260434 TTTCTTCAGCAGCTCAGCTGTGG + Exonic
916578345 1:166086675-166086697 TTCCGGCAGCAGCTGAGCTGGGG + Intronic
916917829 1:169428869-169428891 GTTCTCCAACAACTGAGCTCAGG + Intronic
918710646 1:187724639-187724661 TTTCTGCATCCTCTGACTTCTGG + Intergenic
919507853 1:198422380-198422402 TTTCTGCAGTATGTCAGCTATGG - Intergenic
919899678 1:202034755-202034777 TTTCTGCAGCACCAGGGCCCTGG + Intergenic
920154033 1:203933836-203933858 TTTAAACATCATCTGAGCTCTGG + Intergenic
921072364 1:211672536-211672558 TGTATGCAGAATCAGAGCTCAGG - Intronic
921142094 1:212318450-212318472 TCTCTTCAGCATCAGAGCTAAGG - Intronic
923274105 1:232381908-232381930 TTTCTCCAGCATTCTAGCTCCGG + Intergenic
923663005 1:235975009-235975031 TCTCTGCAACAACTGAGCTCTGG + Intergenic
1063388024 10:5628618-5628640 TTTCATCAGGGTCTGAGCTCTGG + Intergenic
1063389397 10:5639432-5639454 TTTCTGGGGCATCTGAGGTCAGG - Exonic
1064417081 10:15159201-15159223 TTTCTGGAGAATCTGAACTAAGG + Intronic
1064506065 10:16031430-16031452 TTTCTGCAGTGTCCAAGCTCAGG - Intergenic
1065021819 10:21508158-21508180 TCTCCGCAGCCCCTGAGCTCTGG - Intergenic
1065264589 10:23961662-23961684 TTTTGGCAGCAGCTGAGCTAAGG + Intronic
1069299129 10:66884641-66884663 ATTCTGAAGCAACTTAGCTCTGG - Intronic
1069622704 10:69847664-69847686 GCTCTGCAGCATCTCAGCTTGGG + Intronic
1072190278 10:93072534-93072556 GTCCCGCAGCGTCTGAGCTCCGG + Intergenic
1073033926 10:100549779-100549801 TACTTCCAGCATCTGAGCTCTGG + Exonic
1074183420 10:111082203-111082225 TTTCTGAAGCCTCTGAGCCAGGG - Intergenic
1074418261 10:113286263-113286285 TATCCACTGCATCTGAGCTCAGG + Intergenic
1074832189 10:117256736-117256758 TTCCAGAAGCATCTGAGCTCTGG - Intronic
1076043694 10:127273663-127273685 TGTCTCAAGCTTCTGAGCTCAGG - Intronic
1076521177 10:131082342-131082364 TTCCAGCAGCTTCTGACCTCAGG - Intergenic
1077239696 11:1504078-1504100 TTTCTGCAGGCTCTCAGCTGTGG - Intergenic
1077389513 11:2293540-2293562 TTTCTGCAGCAGCCGAGCAGCGG + Intergenic
1077981401 11:7304274-7304296 TTTGTGCAACATCTGAGCCTTGG - Intronic
1079958639 11:26895051-26895073 TTGCTCCTGCATCTGAGCTTTGG - Intergenic
1081181552 11:39991314-39991336 TTTCTCCTGCATCTGAGCGTAGG - Intergenic
1081561204 11:44218685-44218707 GTTATACAGCATCTCAGCTCTGG - Intronic
1081743817 11:45459265-45459287 TACCTGCAGCATCTGAGGCCTGG - Intergenic
1081763591 11:45593844-45593866 TTTCTCCAACATCTGGGCTATGG + Intergenic
1083543648 11:63533005-63533027 CTCCTGCAGCATCTAAGCTTTGG + Intergenic
1085256393 11:75175989-75176011 TATCTGCGGCCTCAGAGCTCAGG + Intronic
1086407910 11:86514891-86514913 TTTTGCCAGCATCTGAGCCCAGG - Intronic
1087149165 11:94843054-94843076 TTTCTGCTGTCCCTGAGCTCTGG - Intronic
1088577082 11:111282913-111282935 TTTCTGCTACAACTGAGCTACGG + Intronic
1089375392 11:117990235-117990257 TTTCTGCACCAGCTGAGCAGTGG - Intronic
1090827011 11:130394659-130394681 TTGCAGCAGCTTCTCAGCTCTGG + Intergenic
1090928631 11:131275651-131275673 TTCCAGCTGCCTCTGAGCTCTGG + Intergenic
1091226281 11:133958062-133958084 TCACTGCAGCCTCTGAGCGCTGG - Intergenic
1091525437 12:1295466-1295488 ATTCTGTAGCATCTAATCTCTGG - Intronic
1092315108 12:7403544-7403566 TTACTCCAGCATCTGATCTTCGG + Exonic
1093542659 12:20305436-20305458 TTCCTCCTGCACCTGAGCTCTGG + Intergenic
1093928184 12:24929360-24929382 TTTTTTCAGCATTGGAGCTCAGG + Intronic
1094815504 12:34179562-34179584 TTTCTCCAACATCTGAGCATAGG + Intergenic
1095824572 12:46517532-46517554 TGTCTGCAGCATTTCAGCTTGGG - Intergenic
1096281349 12:50257324-50257346 CTTCAACATCATCTGAGCTCAGG - Intronic
1097776148 12:63648653-63648675 TTTCAGGATCATCTGAGGTCAGG - Intronic
1102247797 12:111366190-111366212 GCTCTGCAGCATCTGGGCTGGGG + Exonic
1104178585 12:126356277-126356299 TTGGTGGATCATCTGAGCTCGGG - Intergenic
1107409254 13:40143391-40143413 GCTCTGCAGCAGATGAGCTCAGG + Intergenic
1107863960 13:44685633-44685655 ATTTTGTAGCATCTGAGCTAAGG + Intergenic
1108630383 13:52275781-52275803 TCTCTGCAGCGTGTTAGCTCAGG - Intergenic
1108656311 13:52536739-52536761 TCTCTGCAGCGTGTTAGCTCAGG + Intergenic
1108925029 13:55731648-55731670 TTTCTTCAGCATTTGTACTCAGG + Intergenic
1109714256 13:66200605-66200627 TTGCTCTAGAATCTGAGCTCAGG + Intergenic
1111681388 13:91445945-91445967 TGTCTGAAGGATCTGAGATCAGG - Intronic
1112851734 13:103714510-103714532 TTTCTTCAACATCTGAGGCCTGG - Intergenic
1113864791 13:113513962-113513984 TCTCTGCAGCGTCTGGGCTGTGG - Intronic
1114351978 14:21862713-21862735 TTTCATAACCATCTGAGCTCAGG - Intergenic
1116526895 14:45916766-45916788 TTGCTTCTGCATCTGAGCACGGG + Intergenic
1117983730 14:61367117-61367139 TTTCTGCCTTCTCTGAGCTCTGG - Intronic
1119173046 14:72549266-72549288 CTGCCGCAGCAGCTGAGCTCTGG + Intronic
1119936670 14:78598351-78598373 TCTCTGCAGAATCTCAGGTCAGG - Intronic
1120820746 14:88909928-88909950 TTTCTGCATTTTCTGGGCTCTGG - Intergenic
1122602562 14:102928948-102928970 TGTCCGCAGCATCTCGGCTCTGG + Exonic
1122972554 14:105158297-105158319 TGCCTGCAGGACCTGAGCTCCGG - Intronic
1125878261 15:43168526-43168548 TTCCTGAAGCCTCTGAGCCCAGG - Intronic
1127120347 15:55766453-55766475 TTTCAGGAGCATCTTAACTCAGG + Intergenic
1127856560 15:62958409-62958431 CTTCTGGAGCACCTGACCTCTGG - Intergenic
1128840029 15:70842597-70842619 CTTCTGCAGAACCTGACCTCAGG + Intronic
1131649794 15:94386532-94386554 TGTCTGCAGCATCTGCTCCCTGG + Intronic
1132894937 16:2224179-2224201 TTTCTCCAGGATCTGGGCTCTGG + Intronic
1133746012 16:8687241-8687263 GTTCTTCAGAAGCTGAGCTCCGG + Intronic
1134609971 16:15600155-15600177 TTTCTTCAACATCTGAACTGGGG + Intronic
1138119797 16:54390732-54390754 TTTCTGCAGATTCTAAGTTCAGG + Intergenic
1138386123 16:56636648-56636670 GTTCTGCCCCATCTGAACTCAGG - Intergenic
1139893750 16:70271451-70271473 TTACTGCAACATCTGTGCCCTGG - Intronic
1141181649 16:81757044-81757066 TTCCAGCAGCATCTGAGCTCAGG - Intronic
1141799615 16:86297994-86298016 TTTCTGAAGCCGCTCAGCTCAGG - Intergenic
1143215721 17:5223402-5223424 TTTCTGGATCATCTTAGCTGTGG - Exonic
1143456182 17:7069565-7069587 CTCCTGCAGCATCTGCACTCTGG - Intergenic
1143615354 17:8046265-8046287 TATCTGCAGCTTCTGAGGCCTGG + Intronic
1144369997 17:14581154-14581176 TTTCTGCAACATCTCAGATGGGG - Intergenic
1145825031 17:27870500-27870522 TTGCTCCAGCATCTCAGCCCAGG + Intronic
1147677876 17:42219936-42219958 TTAATGCAGTATCTGAGCCCAGG - Intronic
1151601735 17:75110134-75110156 TTACTGCAGAATCTGAACCCAGG + Exonic
1152602148 17:81269460-81269482 CTTCTTCAGCATCTTGGCTCAGG - Intronic
1152814122 17:82397499-82397521 TTTCGGCTGCATCTGGGGTCAGG + Intronic
1155171241 18:23268028-23268050 TGGCTGCAGCATGTGGGCTCTGG - Intronic
1155887517 18:31226030-31226052 CTACTGCATCATCTGAGCTGAGG + Intergenic
1155950427 18:31905324-31905346 TCTGTGCAGCAGCTGAGCTCAGG - Intronic
1157048058 18:44126572-44126594 TTTTTGCAGCTTCTGACTTCAGG + Intergenic
1157088932 18:44612466-44612488 ATTCTGCAGCATTTGAGGCCTGG - Intergenic
1157615528 18:48985256-48985278 TTTCTCCTCCATCTGAGCTGGGG - Intergenic
1157908714 18:51595041-51595063 TTCCTGCAGTATCCCAGCTCCGG - Intergenic
1162057611 19:8074118-8074140 TCACTTCTGCATCTGAGCTCAGG + Intronic
1163788034 19:19287194-19287216 TCACTGCAGCCTCTGCGCTCTGG - Intronic
1164365218 19:27572950-27572972 TTTCTGTAGAATCTGAGATGGGG + Intergenic
1165358275 19:35317556-35317578 CTTCTGCAGAATGTCAGCTCTGG - Intergenic
1165370421 19:35402247-35402269 TCTCTGCAGCATCTGCTCTCTGG - Intergenic
1167285848 19:48598666-48598688 CTTCTGCAGGCTCTGTGCTCAGG - Intronic
925688489 2:6496076-6496098 TCTTTGGAGCAGCTGAGCTCAGG + Intergenic
929568152 2:43003108-43003130 TTTCTCCAGCAACTGTTCTCAGG + Intergenic
929629445 2:43444494-43444516 TTTTTAGAGCATCTGAGCTTTGG + Intronic
929639217 2:43559458-43559480 TTTCTGCTGCAGCTGAGCCATGG - Intronic
929931500 2:46259682-46259704 ATTGGGCAGCATCTGAGATCAGG + Intergenic
930888876 2:56359876-56359898 TTTCTGCAGCATCTGTTCATTGG + Intronic
934045417 2:88169683-88169705 TGTCTGCAGCATCAGAGAGCTGG - Intergenic
941884309 2:170512638-170512660 TTTCTGCAGCAGCTAATCTATGG + Intronic
943087260 2:183327292-183327314 TTTCTACAGAAACTGTGCTCTGG - Intergenic
944805291 2:203275131-203275153 TTTATTCAGAATCTGAGATCAGG + Intronic
946164999 2:217858420-217858442 TTTCTGCTGGATCTGGGCTGGGG - Intronic
947365531 2:229390776-229390798 TTTCTGCAACATATGTGCTCTGG + Intronic
947695730 2:232186620-232186642 ATACTTCTGCATCTGAGCTCAGG - Intronic
948030863 2:234816315-234816337 ATTCTGGAACATCTGACCTCTGG + Intergenic
948596503 2:239082799-239082821 TCTCTGCTGCATCTGACCTGTGG - Intronic
948698842 2:239748098-239748120 CTTCTGCAGCCTCTGAGGTGTGG + Intergenic
1169150935 20:3288805-3288827 TTCCAGCTGCATCTGAACTCAGG + Intronic
1169748310 20:8965260-8965282 TTTCTGCAGATGCTGTGCTCAGG + Intronic
1170761855 20:19258058-19258080 TTTCTGCAGCACCTGCACTCAGG + Intronic
1172253078 20:33493572-33493594 CTTCTGCAGCCTCTTATCTCTGG + Intronic
1173333386 20:42094157-42094179 TTTCTGCAAAACCAGAGCTCAGG - Intronic
1173732265 20:45337188-45337210 TTCCTCCAGCTTCTGGGCTCAGG + Intronic
1175051554 20:56160140-56160162 TCTCTGCAGCAACTGAGTTTTGG + Intergenic
1175273539 20:57751849-57751871 TGTCTGAAGCAGCTGAGCTTTGG + Intergenic
1176514989 21:7777448-7777470 TTTTCTCAGCAGCTGAGCTCAGG + Intergenic
1178649044 21:34407507-34407529 TTTTCTCAGCAGCTGAGCTCAGG + Intronic
1179283467 21:39954754-39954776 GCTCTGCAGCAGCTGTGCTCAGG + Intergenic
1182772208 22:32803702-32803724 TTGCTGCTGCAGCTGAGTTCTGG + Intronic
1183014191 22:34972599-34972621 CTTCTGCAGCACAAGAGCTCTGG - Intergenic
1183474921 22:38030870-38030892 TTTGTCCAGCAACTGAGCTGGGG - Intronic
1183491121 22:38116135-38116157 TTTCTGGAGCATCGTAGTTCCGG + Exonic
1183937868 22:41274156-41274178 TTGCTGCGGCATTTGAGCTGAGG + Intronic
1185158972 22:49211382-49211404 ATTCTGAAGCATCAGAGCTGCGG + Intergenic
949259634 3:2090539-2090561 TTTCTGCTGAATCTGACATCTGG + Intergenic
950096623 3:10334412-10334434 TTTCTGCACCAACTCAGCTCTGG - Intronic
953890860 3:46750713-46750735 TTTCTGCTGCCGCTGAGCTCGGG - Intronic
954429777 3:50464364-50464386 TTTCAGCAGCAGCTGGGCACTGG - Intronic
956997782 3:74847920-74847942 CTTCTCCAGCCTCTGAGGTCTGG - Intergenic
957508323 3:81155061-81155083 TTTCAGCAGCAGCAAAGCTCAGG - Intergenic
957514856 3:81236556-81236578 TTACTGCAGAATCTGAGCTTAGG + Intergenic
958096846 3:88956913-88956935 TTTCTGCAAAATCAGATCTCTGG - Intergenic
960938739 3:122919924-122919946 TCTCTGCAGAATGTGAGCGCAGG + Intronic
961743958 3:129051535-129051557 TTACTGCAGCCTCTGTGTTCTGG - Intergenic
962294726 3:134172766-134172788 TTTCTTTATCATCAGAGCTCTGG + Intronic
964627957 3:158776978-158777000 TCTCTGGAGCTTCTGAGGTCTGG + Intronic
964635244 3:158851160-158851182 TAGCTACACCATCTGAGCTCTGG - Intergenic
966247599 3:177826106-177826128 TTTCCCCAGCATATGGGCTCAGG + Intergenic
966987988 3:185199818-185199840 TTTCTGCAGCCTCTATGCCCTGG + Intronic
969894694 4:10292567-10292589 TCTCTGAAGCATCTGAAATCTGG + Intergenic
970194850 4:13543442-13543464 GTTCTGCAGATTCTCAGCTCTGG + Intronic
973590339 4:52434435-52434457 GATCTGCAGAACCTGAGCTCAGG - Intergenic
978500739 4:109407595-109407617 TTTCTACAGCCTGTGAGCTGGGG + Intergenic
979040681 4:115789220-115789242 TTTCTTCAGCATTTGAACTCTGG - Intergenic
979399354 4:120229148-120229170 ATTCTGCAGCAGATGGGCTCTGG + Intergenic
979804863 4:124958777-124958799 TTGCTCTAGCATCAGAGCTCCGG + Intergenic
983442193 4:167801052-167801074 TTTCTCCAGCATGTGAACTTGGG + Intergenic
983574118 4:169241620-169241642 TTTCTGGAGCAGCTGAACTTGGG - Intronic
984142485 4:176020792-176020814 TTACTGCAACATTTGAGTTCTGG + Intergenic
993234746 5:85289954-85289976 TTTTCCCAGCATCTGATCTCTGG - Intergenic
994083754 5:95735882-95735904 GGTCTCCAGCTTCTGAGCTCAGG - Intronic
995668803 5:114576056-114576078 TTTTTTCAGTTTCTGAGCTCTGG - Intergenic
995686968 5:114782235-114782257 CTTGTGCAGACTCTGAGCTCAGG + Intergenic
999001165 5:147924454-147924476 TTTGTGGATCATCTGAGGTCAGG + Intergenic
1000164240 5:158631989-158632011 TTTCTCCAGCAGCAGAGCTTAGG + Intergenic
1000940042 5:167349377-167349399 ATTCTGTAGCTTCTTAGCTCTGG - Intronic
1001039382 5:168321897-168321919 TTTCTGCATAATGTCAGCTCAGG + Intronic
1001421280 5:171589218-171589240 TATTTGCAGCCTCTGAGCTCAGG - Intergenic
1001952664 5:175827064-175827086 TTGCTGCAGCTGCTGAGCTGTGG - Intronic
1002980236 6:2128824-2128846 TTTCTCCCTCCTCTGAGCTCTGG - Intronic
1003977572 6:11358329-11358351 TTTCTGCAGCTTCTGACATCAGG - Intronic
1005422578 6:25668105-25668127 TTCCTGCAGAGTCTGAGCTCAGG + Intronic
1010773103 6:79855209-79855231 TTTCTACAGAATCTGAGATTTGG + Intergenic
1011610948 6:89150072-89150094 TTGCTGAAGCAGCTGAGCACTGG - Intronic
1012030042 6:94048336-94048358 CTTCTGTGGCATCAGAGCTCAGG + Intergenic
1014620565 6:123661648-123661670 TTTCTGGAACTCCTGAGCTCAGG + Intergenic
1014708485 6:124778154-124778176 TTACCACAGCATCAGAGCTCAGG - Intronic
1015583204 6:134749066-134749088 TAGCTGGATCATCTGAGCTCAGG - Intergenic
1018372946 6:163185620-163185642 TTCCTCCAGCATCTTATCTCAGG - Intronic
1018608888 6:165626984-165627006 TTTCTCCTGCCTCTGAACTCTGG - Intronic
1022050106 7:26658787-26658809 TTTGAACAGCATCTGAGCTGGGG - Intergenic
1022567919 7:31422220-31422242 TTTCTGGAGCTTCTGCGCCCTGG - Intergenic
1023507171 7:40911831-40911853 TTCCTTCAGCATGTGAACTCAGG - Intergenic
1026543638 7:71302575-71302597 TGTCTGTTGCCTCTGAGCTCAGG + Intronic
1027540015 7:79454147-79454169 TTTCTGCTCCATCGGAGCCCAGG - Intergenic
1031880574 7:127193816-127193838 TTTCTGCAGTATCTGTTTTCAGG + Intronic
1032487305 7:132297425-132297447 TTTCTGGAGTCCCTGAGCTCAGG - Intronic
1034065754 7:148135630-148135652 TTTCTGGAGCTCCTGACCTCAGG - Intronic
1035667488 8:1389640-1389662 ATTCTGCACAATCTGAGGTCTGG - Intergenic
1037219855 8:16505150-16505172 TCTCTGCAGTATCTGAGCCCTGG + Intronic
1037954772 8:23047128-23047150 TTTCTGCGGAACCTGAGGTCGGG + Intronic
1038329368 8:26595997-26596019 TTTCTGCAGCTAATGAGCTAAGG - Intronic
1038382639 8:27111089-27111111 TGTTTCCAGCAACTGAGCTCAGG + Intergenic
1038842099 8:31194360-31194382 TTTCTCTAGTAACTGAGCTCAGG + Intergenic
1040453952 8:47577116-47577138 TCTCTGCAGCAATTGAGCTGTGG + Intronic
1041303107 8:56433879-56433901 TTTCAGTAGCTTCTGAGCTGAGG + Intergenic
1041952608 8:63520845-63520867 TTTATGAAGCATCTAAGCTTAGG - Intergenic
1042507930 8:69581302-69581324 TTTCTGCGGCATCAGATCTTTGG + Intronic
1043525860 8:81095890-81095912 TTTGTGCAATATCTGTGCTCAGG + Intronic
1043750740 8:83930639-83930661 TTCCTGCAACATCTGAGATTAGG - Intergenic
1048454864 8:134568704-134568726 TTACTGAAGCATCAGAGCCCTGG + Intronic
1049431804 8:142568819-142568841 TAACTGCAGCTTCTGAGGTCTGG + Intergenic
1050131623 9:2418853-2418875 TTCCTCCAGCAGCTGAGCTCAGG - Intergenic
1050497294 9:6257379-6257401 TTTCTGTATCACCTGACCTCTGG + Exonic
1051370073 9:16351641-16351663 CTTCTGCAGCATCTTTGATCAGG + Intergenic
1055131741 9:72783366-72783388 GTTCTTCAGCATCTGGACTCTGG - Intronic
1056312968 9:85359611-85359633 TTTCTCCAACATCTGAGCACAGG + Intergenic
1056845992 9:90038850-90038872 TAGCTGGAGCATTTGAGCTCTGG - Intergenic
1057875348 9:98749330-98749352 TTTCTGCAGCCTCTGGGGTCAGG - Intronic
1059729976 9:117047080-117047102 TTCCCACAGCACCTGAGCTCTGG + Intronic
1060280740 9:122214013-122214035 CTTCTGCAGCGTCTGAGCGTCGG + Exonic
1061577916 9:131519103-131519125 TTACTGCAGCAGCTGAGTGCAGG - Intronic
1062075467 9:134586293-134586315 TGTTTGCAGCCACTGAGCTCAGG - Intergenic
1185750758 X:2608672-2608694 TTTCTGGAGCGTCCGAGCTGGGG - Intergenic
1188983891 X:36752516-36752538 TTTCTGTAGCATCTTACCCCAGG - Intergenic
1191227199 X:58055626-58055648 TCTCGGCAGCATCTGAACTCCGG + Intergenic
1195207338 X:102615594-102615616 TTCCTGCAGCTGCTGAGCTTTGG + Intergenic
1196866751 X:120077582-120077604 CTTCTGCAGATTCTGAGCTGGGG + Exonic
1196876348 X:120158699-120158721 CTTCTGCAGATTCTGAGCTGGGG - Exonic
1197874053 X:131085433-131085455 TTTCCAAAGCATTTGAGCTCAGG - Intronic
1199982445 X:152928414-152928436 TTGGTGCTGCAGCTGAGCTCGGG - Intronic