ID: 905823164

View in Genome Browser
Species Human (GRCh38)
Location 1:41009781-41009803
Sequence CTGCAGCATCTGAGCTCTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 331
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 311}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905823156_905823164 5 Left 905823156 1:41009753-41009775 CCCTGGCATATTGGCCAGGTCCC 0: 1
1: 0
2: 0
3: 7
4: 111
Right 905823164 1:41009781-41009803 CTGCAGCATCTGAGCTCTGGTGG 0: 1
1: 0
2: 1
3: 18
4: 311
905823151_905823164 28 Left 905823151 1:41009730-41009752 CCCGGAGCTTTCTCACGGTGTTT 0: 1
1: 0
2: 1
3: 8
4: 131
Right 905823164 1:41009781-41009803 CTGCAGCATCTGAGCTCTGGTGG 0: 1
1: 0
2: 1
3: 18
4: 311
905823158_905823164 -9 Left 905823158 1:41009767-41009789 CCAGGTCCCCCTTTCTGCAGCAT 0: 1
1: 0
2: 1
3: 23
4: 202
Right 905823164 1:41009781-41009803 CTGCAGCATCTGAGCTCTGGTGG 0: 1
1: 0
2: 1
3: 18
4: 311
905823152_905823164 27 Left 905823152 1:41009731-41009753 CCGGAGCTTTCTCACGGTGTTTC 0: 1
1: 0
2: 0
3: 8
4: 115
Right 905823164 1:41009781-41009803 CTGCAGCATCTGAGCTCTGGTGG 0: 1
1: 0
2: 1
3: 18
4: 311
905823157_905823164 4 Left 905823157 1:41009754-41009776 CCTGGCATATTGGCCAGGTCCCC 0: 1
1: 0
2: 0
3: 6
4: 116
Right 905823164 1:41009781-41009803 CTGCAGCATCTGAGCTCTGGTGG 0: 1
1: 0
2: 1
3: 18
4: 311

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905823164 Original CRISPR CTGCAGCATCTGAGCTCTGG TGG Intronic
900030304 1:366535-366557 CTGCAGCGTCTTGGCTCTAGAGG - Intergenic
900050958 1:595599-595621 CTGCAGCGTCTTGGCTCTAGAGG - Intergenic
901208906 1:7513428-7513450 CTACCGCCTCTTAGCTCTGGAGG + Intronic
902043461 1:13509032-13509054 CTGGAGCATCTGAGCATTCGGGG - Intronic
902711889 1:18246131-18246153 GAGCAGCATCCCAGCTCTGGGGG + Intronic
903044228 1:20553628-20553650 CAGCAGCATCTCCGCGCTGGGGG + Exonic
903057403 1:20645735-20645757 CTGCACCATCAGAGCTCTCCAGG + Intronic
903285333 1:22273418-22273440 CTGCAGCCCCTCAGCCCTGGTGG - Intergenic
903348741 1:22704782-22704804 CTGCAGCCTCTGTGCTCAGAGGG + Intergenic
903474901 1:23612964-23612986 CTGCAGTTTCTGAGATGTGGAGG - Intronic
903706615 1:25290474-25290496 CTGCAGCATCAGCGCCCAGGTGG + Intronic
903720621 1:25402880-25402902 CTGCAGCATCAGCGCCCAGGTGG - Intronic
904419134 1:30380151-30380173 CTGCAGGAGCTGTGCACTGGAGG + Intergenic
904419156 1:30380253-30380275 CTGCAGGAGCTGGGCACTGGAGG + Intergenic
904559253 1:31385803-31385825 CTGCAGCAGCCGAGCCTTGGAGG + Intergenic
905823164 1:41009781-41009803 CTGCAGCATCTGAGCTCTGGTGG + Intronic
906935782 1:50212920-50212942 CTGTATCATCTAGGCTCTGGCGG + Intergenic
907560233 1:55381192-55381214 CTTCAGCCTTTGAGCTCTGCTGG + Intergenic
908679324 1:66642103-66642125 CTGCAGCTTCTCAGCTAGGGTGG - Intronic
910840427 1:91555879-91555901 CTGGTGCACCTGACCTCTGGGGG + Intergenic
912253736 1:108037983-108038005 CTTCAGAATTTGTGCTCTGGAGG - Intergenic
912545145 1:110445409-110445431 TTGCAGCATATGAATTCTGGGGG - Intergenic
914312738 1:146481348-146481370 GAGGATCATCTGAGCTCTGGAGG + Intergenic
914501610 1:148251990-148252012 GAGGATCATCTGAGCTCTGGAGG - Intergenic
915215407 1:154337238-154337260 CTAGAGCATCTGAGCTTTTGAGG + Intronic
915921752 1:159981058-159981080 CTGCAGCATAGGAGTTTTGGGGG - Intergenic
916143699 1:161722134-161722156 TGGCAGGATGTGAGCTCTGGGGG + Intronic
917276089 1:173333447-173333469 CTTCAGCATATGAGTTTTGGGGG - Intergenic
917819384 1:178746749-178746771 CTGCACCTTCTGAGCTGTGGTGG + Intronic
919507852 1:198422377-198422399 CTGCAGTATGTCAGCTATGGAGG - Intergenic
920215443 1:204359143-204359165 AGGACGCATCTGAGCTCTGGGGG - Intronic
922293373 1:224227733-224227755 CTGCAGCATGTGAATTTTGGGGG - Intronic
923418782 1:233791789-233791811 CTGCAGCATCTGGTATGTGGAGG - Intergenic
924759931 1:246974377-246974399 CTACTGTATCTTAGCTCTGGAGG - Intronic
1062983740 10:1747318-1747340 CTGCAGGATCTGAACTCTGGAGG + Intergenic
1063434007 10:6016063-6016085 TTCCAACACCTGAGCTCTGGGGG - Intronic
1063962841 10:11321350-11321372 CTGCAGCAGCAGAGCGCTGCAGG + Exonic
1067057360 10:43060138-43060160 CTGCACCTTCCGAGCACTGGAGG + Intergenic
1069092841 10:64223243-64223265 CTGCAGCAGCTTGGCTCTTGTGG - Intergenic
1069388528 10:67907719-67907741 CTGCAGGATTTTAGCCCTGGAGG + Intronic
1069622705 10:69847667-69847689 CTGCAGCATCTCAGCTTGGGAGG + Intronic
1070791561 10:79192518-79192540 CCAAAGCATCTGAACTCTGGTGG + Intronic
1072761785 10:98062712-98062734 CAGCAGCAGCTGTGCTCTCGGGG - Intergenic
1074224736 10:111473555-111473577 CTGCACCTTCTAAGCCCTGGAGG + Intergenic
1075235771 10:120727496-120727518 ATGTATCATCTCAGCTCTGGAGG + Intergenic
1075246741 10:120829267-120829289 CTGCAGCATCAGAGCTTGGCAGG - Intergenic
1076804767 10:132849848-132849870 CTGCAGCTTCTGAGCTCCCCAGG + Intronic
1077072914 11:685473-685495 CTCCAGCTCCTGAGCTCAGGTGG - Intronic
1077162595 11:1120591-1120613 CTGCAGGATGTGGGCTCTGCAGG - Intergenic
1077269309 11:1667623-1667645 CTGCAGCTTCTGAGCACTGAGGG - Intergenic
1077739219 11:4826540-4826562 CTGCTGGAACTGAGCCCTGGAGG + Intronic
1078961416 11:16277145-16277167 CTTCAGCATATGAATTCTGGGGG - Intronic
1079626130 11:22619074-22619096 CAGCAGCCTCTGAGCACTGGGGG - Intergenic
1080356598 11:31454360-31454382 GAGGAGCATCTGAGCCCTGGAGG + Intronic
1081473631 11:43401886-43401908 GAGAATCATCTGAGCTCTGGAGG + Intronic
1083047477 11:59749761-59749783 CTGCAGGATCTAAATTCTGGGGG + Intronic
1083235149 11:61346344-61346366 CTGCAGCTTCGGCACTCTGGGGG - Exonic
1083298520 11:61728060-61728082 CTGCAGCCTCCCAGCCCTGGGGG + Intronic
1084662002 11:70551464-70551486 CCCCAGCATCTGGGCTCTGATGG + Intronic
1084715360 11:70870165-70870187 CAGCAGAATCTGAGTGCTGGAGG + Intronic
1085625428 11:78068212-78068234 CTGCTACCTCTTAGCTCTGGAGG - Exonic
1088348095 11:108853250-108853272 CTACAGCCTCTGAGATCTAGTGG - Intronic
1089764001 11:120749754-120749776 CTTCAGCATCTCAGCCTTGGTGG + Intronic
1089793164 11:120958826-120958848 CTGCAGCTGCTTAGCTGTGGTGG - Intronic
1090098279 11:123766379-123766401 CTGAAGCATCTGAAATCTGCAGG - Intergenic
1090343847 11:126051125-126051147 CTGTAGCATTTGAGATGTGGTGG + Intronic
1091327438 11:134701666-134701688 CTGCAGCAGCTGACCACCGGAGG - Intergenic
1091529472 12:1340266-1340288 CTGCAAGACCTGAACTCTGGAGG - Intronic
1091600250 12:1913636-1913658 CTGGAGCTGCTGAGCTCTGCTGG - Intronic
1091761169 12:3088337-3088359 CTGCAGCATGTGGGACCTGGAGG + Intronic
1092239421 12:6828082-6828104 CTTCAGCCCCTGAGGTCTGGGGG - Intronic
1094658974 12:32448083-32448105 CTGCAGCATCTGAAGACTTGGGG - Intronic
1095824571 12:46517529-46517551 CTGCAGCATTTCAGCTTGGGAGG - Intergenic
1096482260 12:51950414-51950436 CTTCACCATCTGAGATCTAGGGG - Intergenic
1096528919 12:52231397-52231419 CTACAGGATCTGCGCTCTGGAGG - Intergenic
1097519622 12:60650377-60650399 CTTCAGCATATGAAATCTGGGGG + Intergenic
1097942466 12:65326735-65326757 CTGCAGAAGCTGTGCTGTGGCGG + Intronic
1101375347 12:104166667-104166689 CGGCATCATCTGAGCCTTGGAGG - Intergenic
1102086606 12:110146034-110146056 GTGCATCATCTGAGGTCAGGAGG - Intronic
1103140127 12:118541023-118541045 CTCCAGCAGCTGAGGTCCGGAGG + Intergenic
1104713834 12:131004132-131004154 CTGCAGCCTGTGAGCTCTGACGG + Intronic
1105591839 13:21799692-21799714 CAGGAGCATGTGAGCTCAGGAGG - Intergenic
1106527503 13:30554734-30554756 CTGCACCTTCTGAGCTGTGGTGG - Intronic
1106544180 13:30715992-30716014 TTGCAGCAGCTCAGCTCTGGAGG - Intronic
1106701330 13:32232458-32232480 GTTAAGCCTCTGAGCTCTGGGGG - Intronic
1110716403 13:78710001-78710023 CTGCAGCATTTGACCTCTCCAGG + Intergenic
1112826264 13:103395929-103395951 CTGCAGCATTTGAGGAATGGTGG + Intergenic
1113653579 13:112054967-112054989 AGTCAACATCTGAGCTCTGGCGG + Intergenic
1113943434 13:114030203-114030225 CTGCAGCATCAGAGCCTTTGGGG - Intronic
1113958935 13:114114950-114114972 CTGCAGCATCTCACAGCTGGGGG - Intronic
1113958946 13:114114987-114115009 CTGCAGCATCTCACAGCTGGGGG - Intronic
1113958957 13:114115024-114115046 CTGCAGCATCTCACAGCTGGGGG - Intronic
1113958968 13:114115061-114115083 CTGCAGCATCTCACAGCTGGGGG - Intronic
1115486496 14:33915818-33915840 CTGGATCATGTGAACTCTGGAGG + Intergenic
1121273556 14:92652953-92652975 CTGCAGCATCTCCGTGCTGGAGG - Exonic
1121573146 14:94962395-94962417 CTGGAAATTCTGAGCTCTGGTGG + Intergenic
1121664422 14:95661027-95661049 CTGCATCATCCAAGCTCTGTGGG + Intergenic
1122202737 14:100132416-100132438 CTGTAGCATCTGAGGCGTGGAGG - Intronic
1122264310 14:100539573-100539595 CTGCAGCTTCTGGGCTCTCCTGG - Intronic
1122437136 14:101708005-101708027 CAGGAGCATGTGAGCACTGGTGG - Intergenic
1122552196 14:102556175-102556197 CTCCAGCATCTGGCATCTGGAGG + Intergenic
1122641150 14:103160438-103160460 CGCCAGCATCTGGGCCCTGGAGG - Intergenic
1123215800 14:106808236-106808258 CTGCAGCCTCTGAGGTGTGCAGG + Intergenic
1125278853 15:38023330-38023352 CTGCTCCATATGAGCCCTGGGGG + Intergenic
1125542696 15:40479494-40479516 CTGCTGCCCCTGGGCTCTGGCGG - Intergenic
1125753841 15:42049137-42049159 CTGCAGAAGATGAGCTCTTGTGG + Intronic
1126612595 15:50544627-50544649 CTGCAGCATCTTGCCGCTGGTGG - Exonic
1127285995 15:57534249-57534271 CTGCATCATCTGAGATAGGGAGG + Intronic
1128364217 15:66985895-66985917 GTCCAGCATCTGAGCCCGGGTGG + Intergenic
1129267986 15:74404231-74404253 CTGGAGACTTTGAGCTCTGGGGG - Intergenic
1129329475 15:74819727-74819749 CAGTAGCAGCTGTGCTCTGGGGG + Intronic
1129409462 15:75341036-75341058 CTTCAGCATATGAATTCTGGAGG - Intronic
1130025421 15:80266975-80266997 CTGCAGCATCAGAGCTCCTGTGG - Intergenic
1130624209 15:85496784-85496806 CTCCAGCATCTGTGGGCTGGTGG + Intronic
1131257191 15:90870764-90870786 TTGCAGGATCTGAGGTCTGCTGG + Intronic
1131577311 15:93604956-93604978 CTGCCACATCTCATCTCTGGTGG + Intergenic
1132146780 15:99433832-99433854 CTCCAGCCTGTGGGCTCTGGGGG + Intergenic
1133305350 16:4804777-4804799 CTACAGCCTCTTCGCTCTGGGGG + Exonic
1133914010 16:10092423-10092445 CTGCACCCTCAGACCTCTGGAGG - Intronic
1134503430 16:14786853-14786875 CTGCAAAAACTGACCTCTGGGGG - Intronic
1134577138 16:15342045-15342067 CTGCAAAAACTGACCTCTGGGGG + Intergenic
1136534745 16:30893106-30893128 CTGCTGCATCTGAGGTCTCGGGG + Intronic
1138022146 16:53494343-53494365 CTGCAGCCTCTGGGTTCAGGGGG + Exonic
1139750790 16:69107687-69107709 CTTCAGCATGTAAGCTCCGGAGG + Exonic
1142358609 16:89615747-89615769 CTGCAGCTCCTGCCCTCTGGTGG - Intronic
1143109122 17:4543725-4543747 CCCCAGCACCTGAGCTCTGAAGG + Intronic
1144156563 17:12509489-12509511 CTGATACATATGAGCTCTGGGGG + Intergenic
1144586110 17:16488831-16488853 CTTCAGCATCTAAGATTTGGAGG - Intronic
1145917272 17:28582169-28582191 CTGCAGCGTGAGAGCTCTGTGGG - Intronic
1145924618 17:28636964-28636986 CAGCAGCATCCGCTCTCTGGAGG - Exonic
1146403123 17:32515939-32515961 CAGAAGCATCTGAGCAGTGGAGG - Intronic
1146491121 17:33283107-33283129 CAGAAGCATCAGTGCTCTGGGGG - Intronic
1147383125 17:40067304-40067326 GTTCAGGGTCTGAGCTCTGGGGG + Intronic
1147389978 17:40103191-40103213 CTCCACCCTCTGGGCTCTGGAGG + Intergenic
1147605758 17:41772910-41772932 CCGCAGCCTCTGACCTCTGCAGG - Intronic
1147677875 17:42219933-42219955 ATGCAGTATCTGAGCCCAGGAGG - Intronic
1150575828 17:66430237-66430259 CTGGAGCCTCTAGGCTCTGGGGG + Intronic
1151217385 17:72586780-72586802 CTTCAGCATGTGGGCTGTGGTGG - Intergenic
1151708390 17:75784933-75784955 CTGCAGCACCTGAGCGGTAGCGG - Exonic
1151963018 17:77417286-77417308 CTCCAGCAGCCAAGCTCTGGAGG + Intronic
1152178273 17:78802009-78802031 CTACTGCATCTGAGCTTGGGAGG - Intronic
1152268764 17:79311503-79311525 CTGCCGAATCTGAACTCTGTAGG - Intronic
1152784335 17:82240169-82240191 CTGCAGCCTCAGGGCTGTGGAGG + Intronic
1152788657 17:82266043-82266065 CTGCAGCACCTGAAGACTGGTGG - Intronic
1152949454 17:83220022-83220044 CTGCAGCGTCTTGGCTCTAGAGG + Intergenic
1154257279 18:12794428-12794450 CTGCACCTTCTGAGCTGTGGTGG + Exonic
1155203413 18:23536926-23536948 CAGCAGAATCTGAGCACTTGAGG + Intronic
1155280512 18:24234950-24234972 CTACTGCATCTGAGGCCTGGAGG + Intronic
1155589177 18:27405276-27405298 CTGCAGCATCTGCTCTCTGCTGG - Intergenic
1157088931 18:44612463-44612485 CTGCAGCATTTGAGGCCTGGTGG - Intergenic
1158303070 18:56074576-56074598 CTGCAGGCTGTGAACTCTGGAGG + Intergenic
1158494648 18:57943398-57943420 CTGGAGCACCCGGGCTCTGGTGG + Intergenic
1159014271 18:63088701-63088723 CTGCAGCCACTGAGCCCTGAAGG - Intergenic
1160345216 18:78127152-78127174 CTGGAGCCTCTGAGGGCTGGTGG - Intergenic
1160523914 18:79524514-79524536 CTGCAGCGTCTGAGACCTTGTGG + Intronic
1160580886 18:79884174-79884196 CTGCAGCTTCTGTGCTGTGCTGG - Intronic
1161087414 19:2341426-2341448 CTGCGGCTTCTGAGCAGTGGTGG + Intronic
1162966091 19:14156807-14156829 CTGCAGCCTCTGGGATCAGGAGG + Intronic
1165379512 19:35468425-35468447 GTGAAGCTTCTGAGCTCGGGCGG - Intergenic
1167013023 19:46821544-46821566 CTGCCCCTTCTGAGCTGTGGTGG + Intergenic
1167455473 19:49595266-49595288 CAGCACTATCTGAGCTGTGGAGG + Exonic
1167611539 19:50510240-50510262 CTGGAGCAGCAGAGCTCTGGCGG - Intronic
1168684072 19:58337403-58337425 CTGCAGGCTCTGATCTCTGTGGG - Intronic
1168684086 19:58337481-58337503 CTGCAGGCTCTGATCTCTGTGGG - Intronic
1168684100 19:58337559-58337581 CTGCAGGCTCTGATCTCTGTGGG - Intronic
1168684114 19:58337637-58337659 CTGCAGGCTCTGATCTCTGTGGG - Intronic
1168684128 19:58337715-58337737 CTGCAGGCTCTGATCTCTGTGGG - Intronic
1168684142 19:58337793-58337815 CTGCAGGCTCTGATCTCTGTGGG - Intronic
1168684155 19:58337871-58337893 CTGCAGGCTCTGATCTCTGTGGG - Intronic
925987842 2:9230601-9230623 ATCCAGCATCTCAGTTCTGGGGG - Intronic
926298591 2:11586278-11586300 CTGCAGGAGCTCCGCTCTGGTGG + Intronic
926742415 2:16123692-16123714 CTGCAGCACTTGTGCCCTGGGGG + Intergenic
927098886 2:19771573-19771595 CTTCAACATCTGAATTCTGGGGG + Intergenic
927514183 2:23662497-23662519 CTGCAGCTTCTGCTCTCTGGCGG + Intronic
928529760 2:32178951-32178973 CTGGATCATTTGAGCTCAGGCGG - Intronic
928689743 2:33787117-33787139 CTGAATCATCTGAGCTCATGTGG + Intergenic
929378908 2:41325604-41325626 CTTCAGCATATGAGTTGTGGTGG + Intergenic
932803909 2:74766893-74766915 CTGGAGCATCCGAGGACTGGTGG - Intergenic
934734138 2:96679854-96679876 CTGCAGCATCTAATCTCCCGTGG + Intergenic
934946736 2:98547846-98547868 CTGCAGCATGTGGGCTGGGGAGG + Intronic
935847965 2:107187427-107187449 CTGCTGCACCTGAACTCTGCAGG + Intergenic
937377835 2:121349760-121349782 GAGCAGCCTCTGACCTCTGGAGG + Intronic
941876306 2:170437173-170437195 CAGCAGCTTCTGAGTCCTGGGGG - Intronic
942405190 2:175646567-175646589 CTGTAGGACCTGAACTCTGGAGG + Intergenic
944785877 2:203069740-203069762 CTGCAACTTGTGAGCTCAGGTGG + Intronic
947499503 2:230661648-230661670 CTTCTACATCTGAGCTCTGTGGG - Intergenic
947525338 2:230873877-230873899 GTGCAGGGTCTGAGCTGTGGAGG - Intronic
947652130 2:231795855-231795877 CTGCAGCATGTGAAATCTGAAGG + Intronic
947695729 2:232186617-232186639 CTTCTGCATCTGAGCTCAGGAGG - Intronic
948371353 2:237491427-237491449 CTGCAGCATCTGAGGGCCGAGGG + Intronic
948966121 2:241381826-241381848 CTGCAGCATCTCAGCTTTCTGGG + Intronic
1168931294 20:1626582-1626604 CCCCAGCCTCTGAGCTCTGCAGG + Intergenic
1168995995 20:2133680-2133702 CTGCAGATTCTGAGATTTGGAGG - Intronic
1169074155 20:2751240-2751262 CTGCAGCATCTGAAGGCTAGAGG - Intronic
1169383442 20:5127733-5127755 CTGCACCGTGTGGGCTCTGGTGG + Intronic
1171012260 20:21515108-21515130 CTGCTGCCTCTGGGCTCTGCGGG + Intergenic
1171901851 20:30865753-30865775 TTCCAACATGTGAGCTCTGGGGG - Intergenic
1172298450 20:33830731-33830753 CTTCAGCATATGAATTCTGGGGG + Intronic
1174493069 20:50917099-50917121 GTGCTGCATCTCAGGTCTGGAGG - Intronic
1175159634 20:56998431-56998453 GTGCAGCATCTGTGCTCAGCAGG - Intergenic
1178396248 21:32246287-32246309 GAGCAGCAGCTGAGCTCTGCTGG - Intergenic
1178499757 21:33115992-33116014 CGGCAGCATCCGAACTCTTGTGG - Intergenic
1178528245 21:33351247-33351269 CTCCAGCATCTACGGTCTGGTGG - Intronic
1179369623 21:40792545-40792567 CTTCAGCATATGAATTCTGGAGG + Intronic
1179732758 21:43376600-43376622 CTGCCTCCTCTGAGCTCTGCAGG + Intergenic
1179819868 21:43930559-43930581 CTGCAGCCTCTGAGTTCACGGGG - Intronic
1180335227 22:11571694-11571716 TTCCAACATGTGAGCTCTGGGGG - Intergenic
1181029485 22:20142972-20142994 CTGCAGCCCCTGCGCTCTGAGGG + Exonic
1182128567 22:27834398-27834420 CCGCAGCTTCTGGGCTCTGTGGG - Intergenic
1182755036 22:32672719-32672741 CTGCAGCCTGTGAGCTGGGGAGG + Intronic
1183119828 22:35721788-35721810 TTGCTGCAGCTGAGCTCTGTGGG - Intronic
1183581484 22:38729102-38729124 GTGCAGGCTCTGGGCTCTGGGGG + Intronic
1183714056 22:39523371-39523393 CTGCAGCTTCGGACTTCTGGCGG + Intergenic
1183949371 22:41344185-41344207 ATGCAGCCTCACAGCTCTGGAGG + Intronic
1184150840 22:42637628-42637650 CTGTAGGGTCTCAGCTCTGGGGG - Intronic
1184413814 22:44340602-44340624 GTTGAGCATCTGAGCTATGGTGG - Intergenic
1184916659 22:47574114-47574136 CTTCAGCCTCTCAGCTCTGTTGG + Intergenic
1185133772 22:49056804-49056826 CTGCAGAGTGTGAGCTGTGGAGG - Intergenic
950498734 3:13350553-13350575 CTGGTGAATCTGATCTCTGGTGG - Intronic
952375985 3:32767826-32767848 CTGCAGTGACTGAGGTCTGGGGG - Intronic
952992804 3:38846630-38846652 CTTCAGCCTCTGAGCTCCAGGGG - Exonic
953889808 3:46743376-46743398 CTGCAGACTCTCAGCTCTGCTGG + Intronic
953993254 3:47499933-47499955 CTGCAGCTTCCGAGTCCTGGTGG + Intronic
954328038 3:49874292-49874314 CTGCAGCAGCTGAACTCGTGAGG + Intergenic
954841576 3:53516230-53516252 TGGCAGTATCTGAGCACTGGGGG + Intronic
954976951 3:54704974-54704996 CTGCATTCTCTGAGCTCTGCTGG + Intronic
958262706 3:91401492-91401514 TTGCAGCACCTGAACTTTGGAGG - Intergenic
960393088 3:117103422-117103444 CTGCAGCGGCTCAGCACTGGAGG + Intronic
960703344 3:120458600-120458622 CTGCAGAATCTAAGGTCTTGGGG + Intergenic
961143425 3:124574655-124574677 CTGCACCATCTTTCCTCTGGGGG - Intronic
961385391 3:126520435-126520457 CTGCAAGATCTTAGCACTGGGGG + Intergenic
961484208 3:127206253-127206275 TTGCAGAGCCTGAGCTCTGGAGG + Intergenic
967880977 3:194301160-194301182 ATGCCGCATATGAGCTGTGGAGG - Intergenic
968939230 4:3629421-3629443 CTGCAGCCTCTGAGCTCATCTGG + Intergenic
971942585 4:33235125-33235147 ATGCAACATCTGAGATATGGAGG + Intergenic
972989437 4:44805359-44805381 CTGAAGAAGCTGAGGTCTGGAGG - Intergenic
974722303 4:65756490-65756512 CTGCCACATCTTAGCTCAGGGGG - Intergenic
978112054 4:104975749-104975771 CAGAAGCAGCTTAGCTCTGGAGG - Intergenic
979137296 4:117125586-117125608 CAGCAGCTGCTGAGGTCTGGGGG - Intergenic
979663535 4:123285685-123285707 CTCCCTCATCTGAGCTATGGTGG + Intronic
980084709 4:128379289-128379311 CAGCAGTCTCTGAGCTCTTGTGG + Intergenic
982391470 4:154868958-154868980 CTGCAGGAACTCAGCTCTAGAGG - Intergenic
983292996 4:165830160-165830182 CTTCACCATCTGTTCTCTGGGGG + Intergenic
984663793 4:182403809-182403831 CTGGAGGATCTGAGCCCAGGAGG - Intronic
985130612 4:186734906-186734928 TTTCAACACCTGAGCTCTGGGGG + Intergenic
985422164 4:189795261-189795283 CTGCACCCTCTGAGCTATGTGGG + Intergenic
986669210 5:10127931-10127953 CTTCAGCATGTGAATTCTGGGGG - Intergenic
986679201 5:10218176-10218198 CTTCAGCATATGAATTCTGGAGG - Intergenic
987912857 5:24170946-24170968 CTGCAGCCTCTGGGTTCAGGGGG - Intronic
990155968 5:52877713-52877735 CTGCAGCGTTACAGCTCTGGTGG - Intronic
991090007 5:62685126-62685148 CTGCAGAATCTGAGCCTTGTGGG + Intergenic
995578947 5:113574241-113574263 CTGAGGCAACTGAGGTCTGGTGG - Intronic
1001256061 5:170184246-170184268 CTGCAGGAGCTGACCTCTAGGGG - Intergenic
1001717795 5:173831167-173831189 CCTCAGCCTCTGAGCTCTGTAGG + Intergenic
1002743685 5:181453837-181453859 CTGCAGCGTCTTGGCTCTAGAGG + Intergenic
1003128819 6:3377847-3377869 CTGCAGCGGCTGTTCTCTGGAGG - Intronic
1003191813 6:3881096-3881118 ATGCAGGATCTGAGCTCCTGGGG + Intergenic
1003673402 6:8180753-8180775 TTTTAGCATTTGAGCTCTGGAGG + Intergenic
1003778148 6:9392400-9392422 CTGCAGACTCTGAGCGCTTGTGG + Intergenic
1004264925 6:14140870-14140892 GTGCACCATCTGAGCTCTTCTGG + Intergenic
1005006533 6:21292720-21292742 CTTCAGCATGTGAATTCTGGGGG + Intergenic
1005182899 6:23126466-23126488 CTGCAGCATATGAATTTTGGGGG + Intergenic
1005353054 6:24955377-24955399 CCGGGGCATCTGAGCCCTGGGGG + Intronic
1005671738 6:28113375-28113397 TTCCAGCATGTGAACTCTGGGGG - Intergenic
1008992708 6:57621394-57621416 TTGCAGCACCTGAACTTTGGAGG + Intronic
1009181330 6:60520505-60520527 TTGCAGCACCTGAACTTTGGAGG + Intergenic
1009763537 6:68038906-68038928 CTACAGCATTGGAGCTCTGACGG - Intergenic
1013875749 6:114825601-114825623 CTGCAGCCACAGAGCTGTGGTGG + Intergenic
1014708481 6:124778151-124778173 CCACAGCATCAGAGCTCAGGGGG - Intronic
1015128745 6:129785851-129785873 CAGCAGCTGCTGAGCTTTGGGGG - Intergenic
1016105788 6:140160400-140160422 CTGCAGCATCTATACTCAGGTGG - Intergenic
1017360043 6:153557542-153557564 CTGAAACATCTGAGTTTTGGAGG - Intergenic
1018037113 6:159890992-159891014 CTGCAGCCTCTCATCTCTGAAGG - Intergenic
1019248543 6:170727066-170727088 CTGCAGCGTCTTGGCTCTAGAGG + Intergenic
1019520493 7:1458691-1458713 CAGCAGCACCTGGGGTCTGGGGG + Intronic
1019559509 7:1648966-1648988 CTTCAGCATTTGAGCTTCGGGGG + Intergenic
1019647588 7:2139325-2139347 CTGCAGCCTGTGAGCTCAGAGGG - Intronic
1021554648 7:21906805-21906827 CATCAGCATCTCAGGTCTGGAGG - Intronic
1022053501 7:26703908-26703930 CTTCAGAACCTGGGCTCTGGAGG - Intronic
1022893788 7:34728468-34728490 CTGGAGCTTCTGAGCTTTGTCGG - Intronic
1025263616 7:57438741-57438763 CTGAGGTATCTGAGGTCTGGAGG - Intergenic
1025635626 7:63317394-63317416 CTGAGGAATCTGAGGTCTGGAGG + Intergenic
1025647070 7:63430786-63430808 CTGAGGAATCTGAGGTCTGGAGG - Intergenic
1025806710 7:64839648-64839670 CTGCAGCAGCTGTGACCTGGCGG + Intergenic
1026503874 7:70965784-70965806 TTGCAACATATGAGCTTTGGGGG + Intergenic
1026788435 7:73316674-73316696 CTGCGGCATCTCTGCTCTGCAGG + Exonic
1027202615 7:76073094-76073116 GTGCAGCAGCTGGGCCCTGGAGG + Intergenic
1031069907 7:117150588-117150610 CTGCAGCTTCTCAGTGCTGGAGG + Intronic
1031658893 7:124395931-124395953 CTTCAACATCTGAGTTTTGGGGG + Intergenic
1031660004 7:124411945-124411967 CTGCAGCACCAGAGCTCTCATGG - Intergenic
1031798376 7:126208451-126208473 TGGCAGCATGTTAGCTCTGGTGG - Intergenic
1032259606 7:130324449-130324471 CTGCCTCATCTGAGGTCTGTAGG - Intergenic
1034672445 7:152868887-152868909 CCTCAGCATATGAGTTCTGGGGG + Intergenic
1035499503 8:80269-80291 CTGCAGCGTCTTGGCTCTAGAGG - Intergenic
1035518349 8:255732-255754 CAGCACCATATGTGCTCTGGTGG - Intergenic
1039427032 8:37494768-37494790 CTGCAGCATCTGGGCTGAGGGGG + Intergenic
1040765756 8:50908876-50908898 CTGCAGCATCCAACATCTGGGGG + Intergenic
1046522988 8:115349506-115349528 CTGCAGGCTCTGACCTCTGCTGG + Intergenic
1048541516 8:135346157-135346179 CTTAAGGTTCTGAGCTCTGGAGG + Intergenic
1048604716 8:135955781-135955803 CAGGAACATCTGAGCTCTGTTGG + Intergenic
1049622569 8:143605233-143605255 CTGCCTCATCTCAGCTCTAGGGG - Exonic
1049698776 8:143997054-143997076 AAGCAGCATCTGGGCCCTGGCGG - Intronic
1052014308 9:23447209-23447231 CTGCTGCCTATGAGCTGTGGTGG - Intergenic
1054451523 9:65405900-65405922 CTGCAGCCTCTGAGCTCATCTGG - Intergenic
1054827809 9:69590466-69590488 CTGGACCAGCTCAGCTCTGGAGG + Intronic
1055972789 9:81928471-81928493 CTGAAGCAACTGAGCACTGAGGG - Intergenic
1055974542 9:81943543-81943565 CTGAAGCAACTGAGCACTGAGGG - Intergenic
1055979567 9:81988776-81988798 CTGAAGCAACTGAGCACTGAGGG - Exonic
1056936797 9:90921270-90921292 CTGCAGCATGTGAGGACAGGAGG - Intergenic
1057217714 9:93238632-93238654 CTGTAGCATCTGAGCACCTGGGG + Intronic
1059250953 9:112887586-112887608 CAGCAGCATCAGAGCTCAGAGGG - Intronic
1059811273 9:117858220-117858242 CTTCAGTATATGAACTCTGGAGG + Intergenic
1061574770 9:131499285-131499307 CGGCAGCATGGCAGCTCTGGTGG + Exonic
1061796213 9:133087224-133087246 CTGCAGCATCTGAGCTTCCTCGG - Intronic
1062332380 9:136050504-136050526 GTGCAGCATCTGAGACATGGCGG + Exonic
1062452019 9:136619802-136619824 CTGAAGCAGCTGGGCTCTGTGGG - Intergenic
1062731869 9:138114447-138114469 CTGCTGCATCTGGTCTCTGGTGG - Exonic
1203609503 Un_KI270748v1:84330-84352 CTGCAGCGTCTTGGCTCTAGAGG + Intergenic
1187391902 X:18891639-18891661 CTGCAGCTTCCCAGGTCTGGGGG - Intergenic
1190024856 X:46913175-46913197 CTGGAGCATCCGACCCCTGGCGG - Intronic
1190948090 X:55115377-55115399 CTCCAGGATCTGTGCTTTGGTGG + Intronic
1194671437 X:96738381-96738403 CTTCAGCCTCAGAACTCTGGGGG - Intronic
1195761477 X:108250768-108250790 CAGCAACCTCTGAGGTCTGGGGG + Intronic
1196950501 X:120871663-120871685 CTACAGAATCGGAACTCTGGGGG - Intergenic
1197269946 X:124414437-124414459 CCGCAGCAGCTGAGATCTGAGGG - Intronic
1198559844 X:137837800-137837822 CTGCAGCATGGTAGCTCTGCTGG - Intergenic
1200071572 X:153531873-153531895 GTGCATCACCTGAGATCTGGAGG + Intronic
1201460855 Y:14222435-14222457 CTCCAGCATTTAACCTCTGGTGG + Intergenic
1201769990 Y:17610215-17610237 CTGCAGCAACTGTGACCTGGCGG - Intergenic
1201831564 Y:18295772-18295794 CTGCAGCAACTGTGACCTGGCGG + Intergenic
1201947836 Y:19531137-19531159 CTGCAGTTGCTGAGCTATGGGGG - Intergenic