ID: 905823165

View in Genome Browser
Species Human (GRCh38)
Location 1:41009802-41009824
Sequence GGTGCTGACCAGATCACACT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 103}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905823158_905823165 12 Left 905823158 1:41009767-41009789 CCAGGTCCCCCTTTCTGCAGCAT 0: 1
1: 0
2: 1
3: 23
4: 202
Right 905823165 1:41009802-41009824 GGTGCTGACCAGATCACACTTGG 0: 1
1: 0
2: 0
3: 6
4: 103
905823160_905823165 5 Left 905823160 1:41009774-41009796 CCCCTTTCTGCAGCATCTGAGCT 0: 1
1: 0
2: 4
3: 54
4: 351
Right 905823165 1:41009802-41009824 GGTGCTGACCAGATCACACTTGG 0: 1
1: 0
2: 0
3: 6
4: 103
905823156_905823165 26 Left 905823156 1:41009753-41009775 CCCTGGCATATTGGCCAGGTCCC 0: 1
1: 0
2: 0
3: 7
4: 111
Right 905823165 1:41009802-41009824 GGTGCTGACCAGATCACACTTGG 0: 1
1: 0
2: 0
3: 6
4: 103
905823157_905823165 25 Left 905823157 1:41009754-41009776 CCTGGCATATTGGCCAGGTCCCC 0: 1
1: 0
2: 0
3: 6
4: 116
Right 905823165 1:41009802-41009824 GGTGCTGACCAGATCACACTTGG 0: 1
1: 0
2: 0
3: 6
4: 103
905823161_905823165 4 Left 905823161 1:41009775-41009797 CCCTTTCTGCAGCATCTGAGCTC 0: 1
1: 0
2: 1
3: 28
4: 262
Right 905823165 1:41009802-41009824 GGTGCTGACCAGATCACACTTGG 0: 1
1: 0
2: 0
3: 6
4: 103
905823162_905823165 3 Left 905823162 1:41009776-41009798 CCTTTCTGCAGCATCTGAGCTCT 0: 1
1: 0
2: 2
3: 34
4: 259
Right 905823165 1:41009802-41009824 GGTGCTGACCAGATCACACTTGG 0: 1
1: 0
2: 0
3: 6
4: 103
905823159_905823165 6 Left 905823159 1:41009773-41009795 CCCCCTTTCTGCAGCATCTGAGC 0: 1
1: 0
2: 2
3: 22
4: 246
Right 905823165 1:41009802-41009824 GGTGCTGACCAGATCACACTTGG 0: 1
1: 0
2: 0
3: 6
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905823165 Original CRISPR GGTGCTGACCAGATCACACT TGG Intronic
901820378 1:11825430-11825452 GCTGCTGAGCAGAGCAGACTCGG + Intronic
903765801 1:25733355-25733377 GGTGGAGGCCAGATCACACATGG - Intronic
905823165 1:41009802-41009824 GGTGCTGACCAGATCACACTTGG + Intronic
906105111 1:43286840-43286862 GGTGGGGGCCAGTTCACACTTGG + Intergenic
916033496 1:160900080-160900102 GGTGGTGAACATCTCACACTGGG + Intergenic
920044085 1:203122314-203122336 GGTCTTGCCCAGAACACACTGGG + Intronic
924416298 1:243859998-243860020 GTTGCTGCCCAGGTTACACTGGG - Intergenic
924638030 1:245807235-245807257 GCTGCTGACCAGGTCTCTCTGGG + Intronic
1065874411 10:29984335-29984357 GTTGGTCACCAGACCACACTTGG + Intergenic
1070933307 10:80275586-80275608 GGTGTTGCCCAGAGGACACTTGG - Intronic
1071249014 10:83796907-83796929 GGTGGTGAACAAAACACACTGGG + Intergenic
1073497352 10:103905369-103905391 AATGCTGACCATATCCCACTGGG - Intronic
1073981433 10:109158533-109158555 GGTGCTGACCAAAACACCCCAGG - Intergenic
1074869849 10:117567977-117567999 GGTGCTGAACAGGACACACTGGG - Intergenic
1076343923 10:129767715-129767737 CCTGCTGCCCAGAGCACACTAGG - Exonic
1076836804 10:133025299-133025321 CGTGCTGATCAGATAACACAGGG - Intergenic
1077289841 11:1783909-1783931 GGTGCTGCCCACCTCAGACTGGG - Intergenic
1078079137 11:8191464-8191486 GGAGCTGACCTCTTCACACTGGG + Intergenic
1079539546 11:21555903-21555925 TGTGCTGGCCATACCACACTTGG - Intronic
1084044471 11:66560742-66560764 GGCACTGACCATATCCCACTTGG - Exonic
1091236629 11:134026543-134026565 GGTGATCACCAGATCACAAAGGG + Intergenic
1092000204 12:5025344-5025366 GGTGCTGAGCAGATTGCTCTGGG + Intergenic
1092749086 12:11701785-11701807 GGTCCTGAGCAGATCACGCAGGG - Intronic
1101396655 12:104354664-104354686 GGAGCTGAGCAGAGCAGACTAGG + Intergenic
1104057881 12:125244521-125244543 GGTGTTGAACAGAGAACACTGGG - Intronic
1104084095 12:125458584-125458606 GGTGGAGATCAGATCACACATGG + Intronic
1112326534 13:98445765-98445787 AGTGAAGACGAGATCACACTGGG - Intronic
1114501597 14:23173415-23173437 GTTGCTAAGCAGATCAGACTTGG + Intronic
1115740007 14:36377805-36377827 GGTCCTGACTAGCTCACTCTGGG - Intergenic
1122922842 14:104887043-104887065 GGTGCTGCCCCCCTCACACTCGG - Exonic
1126640341 15:50818347-50818369 GGTGCTGACCAGCTGATATTAGG - Intergenic
1133855616 16:9546679-9546701 GGTGTTGATCAGATCACATGGGG + Intergenic
1134769867 16:16798895-16798917 GGTCCTTACCAGATCACTCTAGG + Intergenic
1137520265 16:49189006-49189028 TGTGATGACCAAAACACACTTGG - Intergenic
1138494944 16:57402410-57402432 GGTGCTGAACAGATCTTCCTCGG + Intergenic
1140745263 16:77975352-77975374 GGTGCTCACCACACCACACCTGG + Intronic
1144677772 17:17172862-17172884 GGTGCTGACCAGGCCACAGCTGG + Intronic
1148669956 17:49402955-49402977 GGTGGTGGCCCGATCACTCTGGG + Intronic
1151137941 17:71965666-71965688 GGTGGGGACCAGAACACACAGGG + Intergenic
1151354376 17:73549896-73549918 GGTTATGACCAGGTCCCACTTGG - Intronic
1152027753 17:77822732-77822754 GGTGCTGACGAAATCTCACAGGG + Intergenic
1152253934 17:79226542-79226564 GGTGATGCCCAGGACACACTGGG - Intronic
1153002086 18:464887-464909 GGTGCTGAGCACACCCCACTGGG - Intronic
1158465998 18:57690326-57690348 GCTGAGCACCAGATCACACTTGG + Intronic
1161707388 19:5828569-5828591 GGTGCGGACCGGAACACGCTCGG - Intergenic
1162496117 19:11024210-11024232 AGCTCTGACCAGAGCACACTGGG - Intronic
1163813960 19:19452544-19452566 TGTCCTGTCCAGCTCACACTGGG - Intronic
1164792218 19:30996962-30996984 CGTGGTGTCCAGATCACACCTGG + Intergenic
1167459833 19:49619002-49619024 AGTGCAGGCCAGACCACACTGGG - Intronic
929574877 2:43045170-43045192 GGTGCTAGGCAGAACACACTAGG - Intergenic
931503511 2:62898085-62898107 GGAGATGACCAGGTCACACAGGG + Intronic
942089879 2:172479726-172479748 GATGCTCACCATATCCCACTAGG - Exonic
1169772974 20:9221466-9221488 TGTCCTGCCCAGATAACACTGGG - Intronic
1174842603 20:53914396-53914418 GGCGCTGCCCTGAGCACACTGGG + Intergenic
1175538225 20:59730113-59730135 GCTGCTGTACAGGTCACACTTGG + Intronic
1178364266 21:31975483-31975505 GGTGCTGACCAGCTCTAACAGGG + Intronic
1180940889 22:19658983-19659005 GGTGCACACCAGATCCCACGTGG + Intergenic
1181722845 22:24789159-24789181 GTTGTTGACTAGATCACAGTAGG - Intergenic
1181861978 22:25826173-25826195 AGTGATGAGCAGATCACTCTGGG + Intronic
1183662002 22:39226607-39226629 TGTGCTGACCACTTCATACTTGG - Intronic
1184961376 22:47931354-47931376 GGTACTGACCAGCTCATGCTAGG + Intergenic
1185239596 22:49735457-49735479 GGCGCTCACCAGATCTCACCAGG - Intergenic
1185343763 22:50302624-50302646 GGTGGTCACCAGATCAGGCTCGG + Intronic
949302995 3:2606172-2606194 AGTATGGACCAGATCACACTGGG + Intronic
950471209 3:13187606-13187628 GGTGCTGGCCAGCACACAGTAGG + Intergenic
950778111 3:15367799-15367821 GTTACTGACCAGATAATACTAGG + Intergenic
953400729 3:42613408-42613430 GGTTAAGAACAGATCACACTAGG - Intronic
955938662 3:64127560-64127582 GGGGCTGCCCTGATCACACAGGG + Intronic
957136051 3:76290619-76290641 GATGCTGAACAGATGACACCTGG - Intronic
960670705 3:120153147-120153169 GGTGCTGAGCTGCTCACAGTTGG + Intergenic
967452254 3:189638694-189638716 GGTGGTTATCAGACCACACTTGG + Intronic
968630703 4:1649529-1649551 GGTGAGGACCAGGTCACACAGGG + Intronic
969657456 4:8506559-8506581 GGGGCTGCCCAGGTCACACAGGG - Intergenic
978668165 4:111211741-111211763 GGGTCTGCCCAGAGCACACTAGG - Intergenic
984845052 4:184101749-184101771 AGTGCTGAACATATCACCCTGGG - Intronic
985066273 4:186125444-186125466 GGAGCTGATCAGAGCACGCTGGG + Intronic
985344168 4:188985488-188985510 GCTGCTGACCAGTTCCCTCTGGG - Intergenic
989134192 5:38136679-38136701 GGTGCTGACCACCTCTGACTTGG - Intergenic
992080822 5:73233460-73233482 GGGGCTGAAGAGATCACACGCGG + Intergenic
992436256 5:76758631-76758653 GGTGCTGACAATGTCACACCTGG - Intergenic
996396261 5:123017042-123017064 GTTCCTGACCAGATTAAACTGGG - Intronic
1000373850 5:160561239-160561261 GGTGGTGACCAGGTAACACAGGG - Intergenic
1001140459 5:169139707-169139729 GGTGCTGACAATATCATACAGGG + Intronic
1003630461 6:7781963-7781985 GGGGCTGCCTTGATCACACTTGG + Intronic
1005243736 6:23858481-23858503 GGTGAAGACCAGATCAAACTTGG + Intergenic
1006051906 6:31351854-31351876 GCTGGTCTCCAGATCACACTTGG - Intronic
1008714414 6:54271607-54271629 AGTGGTGAACAAATCACACTGGG - Intergenic
1011814774 6:91176050-91176072 GGTGCTGCCTAGATCCCACAAGG + Intergenic
1020100927 7:5394051-5394073 AGTGCTGAGTAGATCACACTAGG + Intronic
1022178655 7:27897122-27897144 GGTGCTGAGCTTCTCACACTGGG + Intronic
1024266187 7:47608438-47608460 GGGGCTGACCTGCTCACACCGGG - Intergenic
1035334870 7:158121337-158121359 GGTGCTGATCAAAGCACACAGGG - Intronic
1036449207 8:8850843-8850865 GGTGCTGACCTGATCTTTCTGGG - Intronic
1036741269 8:11363865-11363887 GGAGCTCCCCAGATCACACCTGG - Intergenic
1037550647 8:19968136-19968158 GGGGCTCCCCAGTTCACACTTGG + Intergenic
1038428344 8:27479849-27479871 GGTGATGTCAAGATCACAGTGGG - Intronic
1041423461 8:57694861-57694883 GGTGCTGGCAAGATGACAATAGG + Intergenic
1044714337 8:95086928-95086950 TGTGTTGACCTGATCACACAGGG - Intronic
1049270792 8:141695010-141695032 GGTGGTGCTCAGGTCACACTGGG + Intergenic
1049934175 9:484778-484800 GGTGCTGCCCAGTGCTCACTGGG - Intronic
1054803070 9:69371596-69371618 ACTGCTTACCAGATCACACCTGG - Exonic
1057212444 9:93207471-93207493 GGGGCTGGCCTGATCACCCTGGG - Intronic
1058115415 9:101079198-101079220 GGAGCTCACCAGACCAGACTGGG - Intronic
1061626054 9:131841399-131841421 GGTGCTGCCCAGATCATCTTTGG + Intergenic
1062657824 9:137613353-137613375 GCAGCTGACCAGCTCACACTGGG - Intronic
1187554766 X:20341223-20341245 GGTGCTGCCCAGACCCCACTGGG + Intergenic
1189130169 X:38490221-38490243 GGTGCTGAGCATATCAAACAGGG + Intronic
1197063009 X:122204243-122204265 GTTGTTAACCAGCTCACACTTGG + Intergenic
1198639611 X:138742221-138742243 GGTGCTGGTCAGATCACATGTGG - Intronic
1201933949 Y:19386173-19386195 GGTGCTGACCTGATGCCAGTAGG + Intergenic