ID: 905823676

View in Genome Browser
Species Human (GRCh38)
Location 1:41013869-41013891
Sequence CTCGAGCAGCCCCGCCACGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 5, 3: 20, 4: 116}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905823673_905823676 5 Left 905823673 1:41013841-41013863 CCCAGATGGCTCTCCAGAGCTTG 0: 1
1: 0
2: 2
3: 8
4: 165
Right 905823676 1:41013869-41013891 CTCGAGCAGCCCCGCCACGCTGG 0: 1
1: 0
2: 5
3: 20
4: 116
905823674_905823676 4 Left 905823674 1:41013842-41013864 CCAGATGGCTCTCCAGAGCTTGC 0: 1
1: 0
2: 2
3: 16
4: 159
Right 905823676 1:41013869-41013891 CTCGAGCAGCCCCGCCACGCTGG 0: 1
1: 0
2: 5
3: 20
4: 116
905823675_905823676 -8 Left 905823675 1:41013854-41013876 CCAGAGCTTGCAAAGCTCGAGCA 0: 1
1: 0
2: 0
3: 5
4: 73
Right 905823676 1:41013869-41013891 CTCGAGCAGCCCCGCCACGCTGG 0: 1
1: 0
2: 5
3: 20
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905823676 Original CRISPR CTCGAGCAGCCCCGCCACGC TGG Intergenic
900171508 1:1271295-1271317 CCCAAGCAGCACCGCCACACAGG + Intronic
900557362 1:3287261-3287283 CTGGAGGCGCCCCGCCACGCGGG + Intronic
900557375 1:3287308-3287330 CTGGAGCCGCCCCGCCACGCGGG + Intronic
900557389 1:3287355-3287377 CTGGAGCCGCCCCGCCACGCGGG + Intronic
900557403 1:3287402-3287424 CTGGAGCCGCCCCGCCACGCGGG + Intronic
900557431 1:3287497-3287519 CTGGAGCCGCCCCGCCACGCGGG + Intronic
900557525 1:3287834-3287856 CTGCAGCCGCCCCGCCACGCGGG + Intronic
903652500 1:24930316-24930338 CTCCGCCAGCCCCGCCCCGCGGG - Intronic
905823676 1:41013869-41013891 CTCGAGCAGCCCCGCCACGCTGG + Intergenic
906263139 1:44407844-44407866 CCCGAGCAGCCCCGCCCCGGGGG - Intronic
913288019 1:117245297-117245319 CTCCAGCAGACCCACCACTCTGG - Intergenic
915837578 1:159189841-159189863 CTGGAGCAGCCCTGACATGCTGG + Exonic
916106989 1:161440250-161440272 CGCGGGCAGCCCCGCCGCGCCGG + Intergenic
916108550 1:161447664-161447686 CGCGGGCAGCCCCGCCGCGCCGG + Intergenic
916110138 1:161455045-161455067 CGCGGGCAGCCCCGCCGCGCCGG + Intergenic
916111723 1:161462455-161462477 CGCGGGCAGCCCCGCCGCGCCGG + Intergenic
916113310 1:161469836-161469858 CGCGGGCAGCCCCGCCGCGCCGG + Intergenic
918612730 1:186511675-186511697 CTCCAGCAGACCCGCAACACAGG - Intergenic
923337053 1:232979640-232979662 CCTGAACAGCCCCGCCAGGCAGG - Exonic
1070775841 10:79109376-79109398 CGGGGGCAGCCCAGCCACGCTGG - Intronic
1075032081 10:119030214-119030236 CTCCAGCAGCCCGGCCTCGGCGG - Exonic
1075697856 10:124449213-124449235 CTGGGGCAGCCCAGCCCCGCAGG + Intronic
1076784344 10:132742295-132742317 CACGCGCAGCCCCGCCCTGCAGG + Intronic
1077309749 11:1883037-1883059 CCCCAGCAGCCCGGCCTCGCGGG + Intronic
1083805233 11:65069534-65069556 CTCCAGCAGCCATACCACGCTGG - Intronic
1084979586 11:72822061-72822083 CTCTCGCAGCTGCGCCACGCGGG - Exonic
1091129438 11:133133231-133133253 CTCCAGCCGCCCTGCCACCCAGG - Intronic
1091759430 12:3077326-3077348 CCCGGGCCGCCCCGCCCCGCAGG + Intergenic
1092206998 12:6620823-6620845 GCAGAGCAGCCGCGCCACGCGGG + Exonic
1092491554 12:8949910-8949932 CTCGCGCACCCCGGTCACGCGGG + Exonic
1097990324 12:65825848-65825870 CGCGAGCAGCCCCGGGAGGCGGG - Intronic
1099956038 12:89353446-89353468 CTCAGGCAGCCCCGCCAGACCGG - Intergenic
1101940764 12:109097771-109097793 CTCAGGCACCCCAGCCACGCCGG - Exonic
1104873615 12:132017648-132017670 CTCCAGTGGCCCCGCCACGTAGG - Exonic
1107911305 13:45108094-45108116 CTCAAGCAGCCCAGCTACTCGGG + Intergenic
1112561892 13:100522513-100522535 ATCGAGCCGCCCCGCCCCCCAGG - Intronic
1113991471 14:16030675-16030697 CTCAACCTGCCCCGGCACGCTGG - Intergenic
1117549094 14:56816753-56816775 CTCGAGCTGCGCCGCCCCGCTGG + Intergenic
1119318435 14:73714442-73714464 CCCGAGCAGCTCCGCCGCGGGGG - Intergenic
1119666941 14:76491594-76491616 CTCCAGCAGCCCCGCGAGGCGGG - Exonic
1122910744 14:104826644-104826666 CTCCGGCAGCCCCGCCCCTCCGG - Intergenic
1122910752 14:104826661-104826683 CTCCGGCAGCCCCGCCCCTCCGG - Intergenic
1202852600 14_GL000225v1_random:30756-30778 CACAACCAGCCCCGGCACGCGGG + Intergenic
1124003137 15:25776236-25776258 TTCGTGCAGCCCTGCCACGAAGG - Intronic
1124323674 15:28737986-28738008 CTCCTGCAGCGCCGCCTCGCCGG - Intronic
1128229597 15:66025310-66025332 CACGAGGAGCCCCCCCACTCAGG - Intronic
1129881082 15:79006326-79006348 CTCCAGCAGCCGCTCCACACTGG + Exonic
1130317682 15:82810136-82810158 CTCCTGCAGCGCCGCCTCGCCGG - Exonic
1132947055 16:2537740-2537762 CCCGCCCAGCCCCGCCCCGCAGG + Intergenic
1132947213 16:2538204-2538226 CCCGGGCCGCCCCGCCTCGCCGG - Intronic
1135517590 16:23148875-23148897 GTTGCGGAGCCCCGCCACGCCGG + Exonic
1142753406 17:2001742-2001764 CTCGAGCAGCCCCTCCTCAATGG + Intronic
1142766771 17:2068812-2068834 CTCCAGCAGCCGCGCCAGACTGG + Exonic
1143598521 17:7929589-7929611 CTCCAGCAGCCCGCCCCCGCGGG - Intronic
1143749883 17:9020906-9020928 GGCGAGCAGCCCCTCCTCGCCGG + Intergenic
1143873497 17:9974819-9974841 CGCCAGCAGCTCCGCCACCCAGG + Intronic
1144666404 17:17105219-17105241 CTCGACCTGCCCCACCACGAGGG - Intronic
1144703427 17:17352768-17352790 CTGGGGCAGCCCAGCCAGGCAGG + Intergenic
1145314391 17:21720766-21720788 CCCGTGCAGCCCCGGCACCCTGG - Intergenic
1147723784 17:42554280-42554302 CGCGAGCAGCACCGCTGCGCTGG - Intronic
1151320400 17:73349171-73349193 CCATAGCAGCCCCGCCAGGCTGG - Intronic
1152321274 17:79609972-79609994 CTCGAGCAGCGCGGCCGGGCTGG - Intergenic
1152922485 17:83072959-83072981 CTCCAGAAGCCCCTCCAGGCAGG - Intergenic
1154133014 18:11752032-11752054 CTCGCTCAGCCCCGCCCAGCGGG - Intronic
1157252233 18:46104807-46104829 CACCAGAAGCCCCGCCGCGCCGG - Intronic
1160677440 19:398958-398980 CTCGACCAGCCCGGCCACCCGGG + Intergenic
1160814492 19:1028847-1028869 CGGGGGCAGCCCCGCCCCGCCGG - Intronic
1160888002 19:1360935-1360957 CCCGCGCAGCACCGCCAGGCTGG + Exonic
1161483741 19:4523831-4523853 CTCCAGCAGCTCGTCCACGCAGG + Exonic
1161797039 19:6393220-6393242 CTCGAGCAGCCGCGTCGCGATGG + Exonic
1164565507 19:29323386-29323408 CTCCAGCACCCCCACCATGCAGG - Intergenic
1164835025 19:31350572-31350594 GTCCAGCAGCCCCGGCAGGCCGG - Intergenic
1165427862 19:35755700-35755722 CTTGAGCGGCCCCGCCCCTCCGG + Intronic
1166729271 19:45049409-45049431 CTCCAGCAGCGCCACCTCGCTGG + Intronic
925725238 2:6865496-6865518 CCCCAGCAGCGCCGCCAGGCGGG + Exonic
933203016 2:79472304-79472326 CACGTGCAGCCCTGCCAGGCAGG + Intronic
933985095 2:87584295-87584317 CCCGAGAAGCCCAGCCTCGCCGG + Intergenic
934966711 2:98730666-98730688 GTCGCCGAGCCCCGCCACGCCGG + Intronic
934978733 2:98823255-98823277 CTCAAGCCGCCCGGCCACCCCGG - Exonic
936308748 2:111366516-111366538 CCCGAGAAGCCCAGCCTCGCCGG - Intergenic
948823252 2:240560866-240560888 CACGCGCAGCTCTGCCACGCCGG - Exonic
1171249436 20:23637346-23637368 CTCGAGCTGCGCCGCAGCGCGGG - Intronic
1171813121 20:29761809-29761831 CTCAACCTGCCCCGGCACGCAGG + Intergenic
1174139539 20:48403478-48403500 CTAGAGCAGCCCTGCCTAGCAGG + Intergenic
1175258175 20:57659250-57659272 CTCGAGCAGCCTCGGGTCGCAGG - Intronic
1176060173 20:63169063-63169085 AGCCAGCAGTCCCGCCACGCAGG - Intergenic
1176304745 21:5117543-5117565 CACGAGCTGCCCCGCCATGGGGG + Intronic
1177905326 21:26966401-26966423 GTCGCGCAGCCCCTCCCCGCGGG - Exonic
1179852309 21:44144487-44144509 CACGAGCTGCCCCGCCATGGGGG - Intronic
1180138469 21:45876413-45876435 CTCCAGCGGCCCAGCCACACTGG - Intronic
1180315797 22:11276849-11276871 CTCAACCTGCCCCGGCACGCTGG + Intergenic
1182697131 22:32205318-32205340 CTCAAGCAGCCCCCCAACACGGG - Intergenic
1182857937 22:33534673-33534695 CTGGGGCAGCCCCGCCTCGGAGG - Intronic
1185005949 22:48277085-48277107 CTGCAGCAGCCCGGCCAGGCTGG - Intergenic
950053922 3:10010894-10010916 CTGGAGCAGCCGCGCCCGGCGGG + Intronic
950912152 3:16605519-16605541 CCCCCGCAGCCCCCCCACGCAGG - Intronic
958732322 3:97972479-97972501 CCCGCCCCGCCCCGCCACGCCGG + Intergenic
960878122 3:122316748-122316770 CTCAAGCAACCCTGCCACTCTGG + Intergenic
961201856 3:125051865-125051887 TTCCAGCAGCCCCGCCCAGCTGG - Intronic
968673428 4:1864339-1864361 CTCAAGCTGCCCCGCCTCCCAGG - Intergenic
969580298 4:8060834-8060856 CACGAGCAGCCCAGCCACAGCGG - Intronic
985680570 5:1253672-1253694 CACCAGCAGCCCTGTCACGCCGG - Exonic
986397286 5:7343468-7343490 CTTGGGCAGCTCCGCCACTCTGG - Intergenic
992444105 5:76819193-76819215 CCCCAGCAGCCACGCCGCGCTGG - Exonic
997013474 5:129904915-129904937 CTCGCTCAGCTCCGCCACCCTGG - Exonic
1006932543 6:37696833-37696855 CTCGGGCTGCGCCGCCTCGCGGG - Exonic
1018624183 6:165761428-165761450 GTCCAGCAGCCCCTCCATGCGGG + Intronic
1019032388 6:169024396-169024418 CCCGGGCAGCCCCGAGACGCCGG - Intergenic
1019171672 6:170136480-170136502 CTCCGGGAGCCCCGCCACCCCGG + Intergenic
1019524256 7:1473715-1473737 CTCGAGCTGCTCTGCCCCGCAGG + Intronic
1019595983 7:1858606-1858628 CCCTAGCAGCCCCGCCAGGTAGG - Intronic
1019716983 7:2543646-2543668 CTCCAGCAGACAGGCCACGCGGG + Exonic
1020273082 7:6608256-6608278 GTCGGGCAGCCCCTCCCCGCCGG + Exonic
1023610346 7:41965615-41965637 CTCGAGCAGCCCTGCCCCGAGGG - Exonic
1029075073 7:97928481-97928503 CACGCGCACCTCCGCCACGCCGG + Intergenic
1033480798 7:141738376-141738398 CCCGAGCAGCCCAGCCACGCAGG - Intronic
1034700112 7:153088231-153088253 CTCGGGCAGCCCTGCCACTCAGG - Intergenic
1036195125 8:6707889-6707911 CTCGAGCTGCCCCGCGACCTGGG + Intergenic
1036258341 8:7222114-7222136 CTCGCGCACCTCCGCCACGCCGG + Intergenic
1036259402 8:7228258-7228280 CTCGCGCACCTCCGCCACGCCGG + Intergenic
1036307222 8:7611266-7611288 CTCGCGCACCTCTGCCACGCCGG - Intergenic
1036310395 8:7680710-7680732 CTCGCGCACCTCCGCCACGCCGG + Intergenic
1036311444 8:7686828-7686850 CTCGCGCACCTCCGCCACGCCGG + Intergenic
1036358064 8:8059253-8059275 CTCGCGCACCTCTGCCACGCCGG - Intergenic
1036892883 8:12607693-12607715 CTCGCGCACCTCTGCCACGCCGG + Intergenic
1042484376 8:69334496-69334518 CTGGAGCAGCCCCGACTCACAGG + Intergenic
1049393527 8:142384208-142384230 CTCCTGCAGCCCTGCCACGGAGG - Intronic
1049643793 8:143727244-143727266 CTCCAGCAGCTCCGCCACCTTGG + Exonic
1049645330 8:143733508-143733530 TCCGAGCAGCCCCGCCACCCCGG + Intronic
1049682419 8:143925509-143925531 CCCCCTCAGCCCCGCCACGCTGG + Exonic
1049685933 8:143939313-143939335 CTCGGGCACCCCCGCCAGGCAGG - Intronic
1051897764 9:22006206-22006228 CAGCAGCAGCTCCGCCACGCGGG + Exonic
1053023106 9:34709275-34709297 CTGGAGCAGCCACCCCATGCTGG - Exonic
1057336205 9:94157077-94157099 CTCGGGCAGCCTGGCCACGGTGG - Intergenic
1061089869 9:128420627-128420649 CTGGAGCAGCCCCGCCCGGCTGG - Exonic
1061501936 9:131009103-131009125 CTCCAGCCTCCCCGCCCCGCAGG + Exonic
1061864702 9:133486139-133486161 CTCGCGCAGCCCCGGCGCTCAGG + Intergenic
1062312679 9:135947707-135947729 CTCTTGCTGCCCCGCCCCGCAGG + Intronic
1187669832 X:21657210-21657232 CTCGGGCACCCGCGCCACGTCGG + Exonic
1191217853 X:57951872-57951894 CTCTAGCAGGCCCGCCAGCCTGG + Intergenic
1199976519 X:152897872-152897894 CTCCAGCAGCCCCGCGGGGCGGG + Intergenic
1200212757 X:154354185-154354207 CTCGTGCAGGCCAGCCTCGCTGG + Exonic