ID: 905824018

View in Genome Browser
Species Human (GRCh38)
Location 1:41015837-41015859
Sequence GCCCTAGGGGAGCTCTGGGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 352
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 320}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905824013_905824018 -10 Left 905824013 1:41015824-41015846 CCCTTATAGCTTAGCCCTAGGGG 0: 1
1: 0
2: 0
3: 5
4: 50
Right 905824018 1:41015837-41015859 GCCCTAGGGGAGCTCTGGGCAGG 0: 1
1: 0
2: 2
3: 29
4: 320
905824006_905824018 26 Left 905824006 1:41015788-41015810 CCTGGGCCAAATGAGCATTTTAG 0: 1
1: 0
2: 2
3: 21
4: 135
Right 905824018 1:41015837-41015859 GCCCTAGGGGAGCTCTGGGCAGG 0: 1
1: 0
2: 2
3: 29
4: 320
905824009_905824018 20 Left 905824009 1:41015794-41015816 CCAAATGAGCATTTTAGGGAGAA 0: 1
1: 1
2: 4
3: 26
4: 446
Right 905824018 1:41015837-41015859 GCCCTAGGGGAGCTCTGGGCAGG 0: 1
1: 0
2: 2
3: 29
4: 320

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905824018 Original CRISPR GCCCTAGGGGAGCTCTGGGC AGG Exonic
900108737 1:996931-996953 GCCCGAGGGGGGCTCTGAGAAGG + Intergenic
900404716 1:2487448-2487470 CCCCGGGGGGATCTCTGGGCAGG + Intronic
900661919 1:3789044-3789066 GCCGGAAGGGAGGTCTGGGCTGG - Intronic
900788636 1:4665573-4665595 GTCCCTGGGGAGCACTGGGCTGG + Intronic
900793488 1:4694062-4694084 GCCCTGGGGGTGTGCTGGGCAGG - Intronic
900956288 1:5888082-5888104 GCCCGCCGGGAGCCCTGGGCTGG + Intronic
901439955 1:9271915-9271937 GAAATAGGTGAGCTCTGGGCAGG + Intergenic
901528089 1:9836559-9836581 GCCCTGGGGCAGGTCTGGGTTGG - Intergenic
902396695 1:16135757-16135779 CACCTTGGGGGGCTCTGGGCAGG + Exonic
902756082 1:18550134-18550156 GGCCTGGCGGAGCTCTGGGAGGG - Intergenic
902925206 1:19691392-19691414 GGCCCAGGTGACCTCTGGGCAGG + Intronic
903052805 1:20614127-20614149 GCCCTGAGGTAGCTCTGGGGAGG + Intronic
903128669 1:21264222-21264244 ACCCAAGGGGAGCCCTGGTCTGG + Intronic
904023943 1:27490294-27490316 GCCCGGGTGGAGCTCTGGGGAGG - Intergenic
905203552 1:36329925-36329947 GCCCTGGGGGAGCTGTGCGGAGG - Intergenic
905204749 1:36336996-36337018 GCCCTGGGGGAGCTATGCGGAGG - Intergenic
905261318 1:36721350-36721372 GGCCTAGGGGAGCTACAGGCTGG - Intergenic
905694971 1:39967450-39967472 TCCCCAGGGGAGCTCAGAGCTGG - Intronic
905824018 1:41015837-41015859 GCCCTAGGGGAGCTCTGGGCAGG + Exonic
906241170 1:44243109-44243131 GCCCCAGGGGGGCAGTGGGCTGG - Intronic
906347197 1:45024436-45024458 GCCCTTGGGGAGGTCGAGGCAGG - Intronic
907278915 1:53332286-53332308 TCCCTGGAGGAGCTCTGGTCTGG + Intergenic
907315449 1:53567972-53567994 GCCCAAGGGGGGCTCTGTGTGGG - Intronic
907673258 1:56495424-56495446 GCCCTAGGGCAGTTCTTGGTAGG - Exonic
911266901 1:95753662-95753684 GCCTTGGGGGAGCTGAGGGCAGG + Intergenic
912451627 1:109770843-109770865 GCCCTAGGGGATCTCAGGGGAGG + Intronic
913970050 1:143408011-143408033 GCTCCAGGAGAGCCCTGGGCTGG - Intergenic
914064424 1:144233608-144233630 GCTCCAGGAGAGCCCTGGGCTGG - Intergenic
914114726 1:144732746-144732768 GCTCCAGGAGAGCCCTGGGCTGG + Intergenic
915339024 1:155166393-155166415 GCCCTCAGGGACCTCCGGGCTGG - Intergenic
919830912 1:201539468-201539490 GCCCGAGGGAGGCTGTGGGCTGG + Intergenic
919897089 1:202015675-202015697 GCCCTAGGGGAGCACCGTGATGG + Exonic
920103198 1:203531241-203531263 TCCCTGGGCTAGCTCTGGGCGGG - Intergenic
922798993 1:228355570-228355592 GCCCCAGGGGATGCCTGGGCAGG - Intronic
922878522 1:228960804-228960826 GCCGAGGGGCAGCTCTGGGCTGG - Intergenic
923776407 1:236982536-236982558 GCCACAGAGGAGCTCAGGGCAGG - Intergenic
924239322 1:242025885-242025907 TCCCTAGGGGATGTCTGGGCCGG - Intergenic
1064996341 10:21299874-21299896 GCCCTGGAGGAGATCTGGGGAGG + Intergenic
1065522982 10:26589884-26589906 GCCCTAGGGGAGGCCAAGGCAGG - Intergenic
1065557997 10:26935848-26935870 GCCCTAGGGGAGGCCAAGGCAGG + Intergenic
1069024124 10:63521614-63521636 GGCCCAGGGGAGCTGTGGGAAGG + Intronic
1069044207 10:63724813-63724835 GCCCAAGGGGGGCTTTGGGGAGG - Intergenic
1070116157 10:73530752-73530774 GCGCAAGAGGAGCTCTGGTCGGG - Exonic
1070811281 10:79299259-79299281 GCCCGAGTGGGGCCCTGGGCAGG + Intronic
1072439379 10:95440227-95440249 GACCTAGGAAGGCTCTGGGCTGG - Intronic
1072555759 10:96512919-96512941 GCCTGAGGGTCGCTCTGGGCGGG - Intronic
1072731633 10:97850369-97850391 GCCCTAGGGGTGGGCTGGGCAGG + Intronic
1073423454 10:103442147-103442169 GGCCTAGGGGAGGTCTGTGGTGG - Intronic
1074055862 10:109922811-109922833 GCCCAAGGAGAGCCCAGGGCAGG + Intronic
1074065228 10:110007753-110007775 TCCCGAGGGGCGCTCGGGGCGGG + Intronic
1075088795 10:119431319-119431341 GCCCTGGAGGAGCTCGGGGCAGG + Intronic
1075159606 10:120011699-120011721 GCCCTCGAGGAGCTCGGTGCTGG + Intergenic
1075378494 10:121998683-121998705 GCCTCAGGAGAGCTCTGTGCTGG + Intronic
1076278565 10:129225769-129225791 TCACTGGGGGAGCCCTGGGCAGG - Intergenic
1076406200 10:130213938-130213960 GGCCTTGGAGAGCTCTGGGGAGG + Intergenic
1076934313 10:133557196-133557218 GCCCCAGGAGGGCACTGGGCTGG + Intronic
1076979476 11:197013-197035 GCTCTAAGGGAGCCCTGGGCCGG - Exonic
1077106252 11:843764-843786 ACCCATGGGGGGCTCTGGGCTGG + Intronic
1077329805 11:1979278-1979300 GCCCGAGGGCAGCCCTGGCCAGG - Intronic
1077392049 11:2304718-2304740 GGCCTATGGGACCTCGGGGCTGG - Intronic
1078181762 11:9017591-9017613 GCCCCAGGAGAGGTCAGGGCTGG - Intergenic
1078535664 11:12171281-12171303 GCCCTAGGGAGTCTCTGGCCAGG + Intronic
1079098074 11:17523629-17523651 GCTCTGGTGGAGCTCTGGGAGGG + Intronic
1079312474 11:19378840-19378862 GCCCTCAGGGAGCTCAGAGCGGG - Intronic
1079373180 11:19869656-19869678 GGCCTATGGCAGCTCTGAGCTGG - Intronic
1080695634 11:34600798-34600820 GCTCTTGGGGAGCTCGGGGGAGG + Intergenic
1080942774 11:36938244-36938266 GCCCCAGAGAAGCTGTGGGCCGG - Intergenic
1081574579 11:44311028-44311050 GCCCTGGAGAAGCCCTGGGCTGG + Intergenic
1083571488 11:63764123-63764145 GCCCTGGGGGGACTCGGGGCGGG + Exonic
1083708988 11:64536021-64536043 ATCCTAAGGGAGCTCTGAGCTGG + Intergenic
1083944348 11:65915773-65915795 GCCCTGGGGAAGCTCAGGGTGGG + Intergenic
1084602222 11:70152648-70152670 GGCCTTGGGGAGCTCAGCGCAGG - Intronic
1084662905 11:70557623-70557645 GGCCTGGGGGAGCTGTGGGTGGG + Intronic
1084795459 11:71501995-71502017 GACCAAGGGGAGCTCTGGAGAGG - Intronic
1088721227 11:112593606-112593628 CCCCTAGGGCAGCTCTGTGAGGG - Intergenic
1089360553 11:117883314-117883336 GCCCAAGTGGAGCGCTGGGCAGG + Intergenic
1089571993 11:119417218-119417240 CCCCTTGGAGAGCTCTGGGCTGG + Intergenic
1089649993 11:119906721-119906743 GCCCTTGGTTTGCTCTGGGCTGG + Intergenic
1202812783 11_KI270721v1_random:34457-34479 GCCCGAGGGCAGCCCTGGCCAGG - Intergenic
1091770192 12:3146310-3146332 GCCCTCGGGGAGCTTAGGGTGGG + Intronic
1091860438 12:3776670-3776692 GTCAGAGGGGAGGTCTGGGCTGG + Intergenic
1092141363 12:6185994-6186016 GCCTCAGTGGAGCTCTGGGCTGG + Intergenic
1096229069 12:49887541-49887563 CTCCTTAGGGAGCTCTGGGCAGG - Intronic
1096239867 12:49954049-49954071 GCACCAGGGGGCCTCTGGGCTGG - Intronic
1097478658 12:60092170-60092192 GCCCTGGGGGAGCTGTGCGGAGG + Intergenic
1098380964 12:69869167-69869189 GCCCTTGGGGAGCTACTGGCAGG - Intronic
1100978129 12:100142940-100142962 GCTCTGGGCGGGCTCTGGGCGGG + Intergenic
1102260691 12:111441501-111441523 GCCCTGAGGGATTTCTGGGCAGG + Intronic
1102646169 12:114405360-114405382 GGTCCCGGGGAGCTCTGGGCTGG + Intronic
1102998138 12:117365147-117365169 GCTCTGGCGGAGCCCTGGGCAGG + Intronic
1103270879 12:119672752-119672774 GCAGTAAGGGAGCACTGGGCTGG + Intronic
1103318280 12:120074509-120074531 GCCCTAAGGGAGCTCATGGAGGG + Intronic
1103719623 12:122966297-122966319 GCACCAGGTGAGCTCTGGGAGGG + Intronic
1103730616 12:123025360-123025382 GCCATAGGTGAGGTCAGGGCAGG + Intronic
1103898670 12:124291816-124291838 GTGCTTGGGGAGCCCTGGGCTGG + Intronic
1104221335 12:126787493-126787515 GCCCTGGGGGAGCTCCTGGCTGG + Intergenic
1104517695 12:129443071-129443093 CCCCAAGGGGAGCTCTGGAGTGG - Intronic
1105458980 13:20566766-20566788 GGCCTAGAGGGGCTCCGGGCTGG - Intergenic
1105960424 13:25330072-25330094 GCCCTTAGGGAGGTCTAGGCAGG - Intronic
1108594882 13:51940869-51940891 GCCCCAGAGCAGCTCTGGTCTGG - Intronic
1110635776 13:77765936-77765958 GGCCTAGTGGAGCTGTGGGAAGG - Intergenic
1112505524 13:99972312-99972334 GCCCTAGGTGAGCGCTAGGCAGG - Intergenic
1114264013 14:21060604-21060626 GGACTTTGGGAGCTCTGGGCTGG - Intronic
1114668836 14:24398501-24398523 GGCCTAAGGAAACTCTGGGCTGG - Intergenic
1116324493 14:43514924-43514946 CACCCAGTGGAGCTCTGGGCTGG - Intergenic
1117735030 14:58760261-58760283 TCCCAAGGGGAGTTCTGGGAGGG + Intergenic
1119650155 14:76377409-76377431 GCCCAAGGGGAGACCCGGGCAGG - Intronic
1121078743 14:91090569-91090591 GCTCTAGGGGAGCTCTGTCCTGG + Intronic
1121307421 14:92915815-92915837 GTCTTTGGGGAGCTCTGGCCTGG - Intergenic
1121814721 14:96920480-96920502 GTGGTAGGGGAGCCCTGGGCTGG - Intronic
1122353120 14:101108935-101108957 GCCCTAGGGGCGCCCTGGGTGGG - Intergenic
1122956863 14:105075196-105075218 GGTCTGGGGGAGCTCGGGGCAGG - Intergenic
1122956883 14:105075240-105075262 GGTCTGGGGGAGCTCGGGGCAGG - Intergenic
1122956903 14:105075284-105075306 GGTCTGGGGGAGCTCGGGGCAGG - Intergenic
1122956921 14:105075326-105075348 GGTCTGGGGGAGCTCGGGGCAGG - Intergenic
1122960373 14:105091393-105091415 ACCCCCGGGGCGCTCTGGGCTGG - Intergenic
1123054437 14:105562367-105562389 AGCCTGGGGGAGCCCTGGGCAGG + Intergenic
1123079021 14:105682786-105682808 AGCCTGGGGGAGCCCTGGGCAGG + Intergenic
1126460066 15:48905374-48905396 GCCCTGGGGGATGTCTGGCCTGG - Intronic
1131829616 15:96345734-96345756 GACCTCGGGGACCTCCGGGCAGG + Intergenic
1132570992 16:643916-643938 GGGCTAGAGGAGCCCTGGGCAGG + Intronic
1132898047 16:2238169-2238191 CCCCATGTGGAGCTCTGGGCAGG + Intronic
1135136423 16:19888110-19888132 GCACTTGGGGAGGCCTGGGCAGG - Intergenic
1135247376 16:20868680-20868702 TCGCTATGGGAGATCTGGGCTGG - Intronic
1136398383 16:30005127-30005149 CCCCCAGGGCAGCTCTGGGGAGG - Intronic
1137251818 16:46746864-46746886 GCAGCAGGGGAGCTCTGGCCTGG + Intronic
1137320613 16:47377770-47377792 GCCCTCAGGGAGCTTTGGACAGG - Intronic
1137720844 16:50626500-50626522 GCCTTGGGGGAGTCCTGGGCAGG + Intronic
1138871236 16:60889488-60889510 GCCCTTTGGGAGGTCTAGGCGGG - Intergenic
1140408241 16:74725136-74725158 GACCGGGAGGAGCTCTGGGCTGG + Intronic
1141470589 16:84235811-84235833 GCCCTGGGGGAGCTCGGTGCTGG + Intronic
1141516605 16:84549100-84549122 GCCCCGGGGCATCTCTGGGCAGG - Intronic
1142007109 16:87694584-87694606 GCACCATGGGAGCTATGGGCTGG - Intronic
1142131456 16:88433330-88433352 CCCCCTGGGGAGCCCTGGGCGGG - Exonic
1142232448 16:88906166-88906188 GCCTTGGTGGAGCTGTGGGCCGG - Intronic
1142307922 16:89295797-89295819 TCCCGAGGGGTGCTCTGTGCAGG + Intronic
1142499997 17:326939-326961 GCCCTGGGGCAGCTTGGGGCTGG + Intronic
1143638955 17:8184391-8184413 GCCCTTTGGGAGCTCGAGGCGGG + Intergenic
1144738543 17:17568459-17568481 GCTCTGGGGCAGCTCTGTGCCGG - Intronic
1145278892 17:21454302-21454324 GCCCTGGGGGAGCTGGGGGAAGG + Intergenic
1146693537 17:34892739-34892761 GCCCTGGGGGTGCTCTGGGCAGG - Intergenic
1146913531 17:36663593-36663615 GCCCCAGAGAAGCTCTGGGGGGG - Intergenic
1148460689 17:47837618-47837640 GCCCAAAGGCAGCTGTGGGCTGG - Exonic
1148750209 17:49941186-49941208 GCCTTAGGGGAGCTGAAGGCTGG - Intergenic
1149701675 17:58660487-58660509 GCTGTAGGGGAGCTCAGGGAGGG + Intronic
1150445426 17:65224410-65224432 GCCTGAGGGGAGATCTGGGAAGG + Intronic
1150455529 17:65304050-65304072 TCCCCAGGGGAGCTCTGGCTAGG + Intergenic
1150924235 17:69515761-69515783 GACCTGGGGCAGCTGTGGGCTGG + Intronic
1151836420 17:76585600-76585622 GCCGCCGGGGAGCCCTGGGCTGG + Intronic
1151944321 17:77311234-77311256 TCCCTAGGGAGGCTCTGGGGTGG - Intronic
1151978035 17:77493273-77493295 GCCCGGGGGGAGGTCTGGGGTGG - Intronic
1152143340 17:78551715-78551737 GCCCTTTGGGAGGTCAGGGCAGG + Intronic
1152433450 17:80261486-80261508 GCCCTGGGGGAGTCCAGGGCGGG + Intronic
1152728699 17:81959829-81959851 GCCCACGGGGAGCTCAGGGACGG + Intronic
1154348321 18:13562773-13562795 GGGCTATGTGAGCTCTGGGCTGG + Intronic
1156242042 18:35264149-35264171 GCCCTCGGGAGGCTCTGAGCCGG - Exonic
1156497480 18:37535696-37535718 TCCCCAGGGGTGCTCAGGGCTGG - Intronic
1157395193 18:47335497-47335519 GCACCAGGGGAGCTAGGGGCAGG + Intergenic
1158400434 18:57116790-57116812 GCCCTATGGGGGCTGTGGGATGG - Intergenic
1160528222 18:79549395-79549417 GCCCGAGTGGGGCCCTGGGCTGG + Intergenic
1160715952 19:576810-576832 ACCTCAGGTGAGCTCTGGGCAGG - Intronic
1160793640 19:934120-934142 GCCCGCAGGGAGCCCTGGGCTGG + Intronic
1161029085 19:2049767-2049789 GCCCTAGGGGAAAACTGGGCAGG + Intronic
1161355846 19:3819277-3819299 ACCCTTGGGGAGTGCTGGGCAGG + Intronic
1161578357 19:5067145-5067167 GCCCTGGGGTATGTCTGGGCGGG - Intronic
1162433333 19:10642543-10642565 GCCCTGGGGAAGCTGGGGGCAGG - Intronic
1162456520 19:10788333-10788355 GCCCTGGGGCAGGACTGGGCCGG + Intronic
1163279001 19:16303698-16303720 GCACTTTGGGAGCTCTAGGCAGG - Intergenic
1163530866 19:17848077-17848099 GCCCTGCGGGAGCTGGGGGCGGG + Intergenic
1163708654 19:18832494-18832516 GCCCGAGGCGAGTTCGGGGCAGG - Intronic
1163771345 19:19192897-19192919 GCAGTGGGGGAGCTCTGGGGTGG + Intronic
1163821721 19:19499876-19499898 GACCTGGGGGAGCTATGGGGAGG + Intronic
1165323244 19:35099160-35099182 GCCCAAGAGGAGCCCTGGTCTGG - Intergenic
1166107353 19:40603931-40603953 GCCCCAGGCCACCTCTGGGCGGG - Intronic
1166142457 19:40812253-40812275 GCCCTAGTGGAGCTGTGCCCTGG + Intronic
1166354851 19:42220880-42220902 GCCCTAGGGGAGTTCTCTGTTGG + Intronic
1167638236 19:50667353-50667375 GCCCTCGGGGAGGTCGGGGAGGG + Exonic
1167659925 19:50790546-50790568 GCCCTGGGGGAGCTAAGGGCAGG - Intronic
1167698273 19:51027358-51027380 GCCCCAGAGGAGCCCTGGGGTGG - Intronic
1168115698 19:54220451-54220473 CCCCCAGGAGAGCTCTCGGCTGG - Intronic
1168118685 19:54240197-54240219 CCCCCAGGAGAGCTCTCGGCTGG - Intronic
1168121507 19:54254659-54254681 CCCCCAGGAGAGCTCTGGGCTGG - Intronic
1168125015 19:54278183-54278205 CCCCCAGGAGAGCTCTGGGCTGG - Intronic
1168176967 19:54633371-54633393 GCCCCAGGAGAGCTCTGGGCTGG + Intronic
1168528545 19:57107015-57107037 CGCCTATCGGAGCTCTGGGCAGG - Intergenic
926196378 2:10765892-10765914 ACTCTAGGGGTGCTCTGGACTGG - Intronic
927151660 2:20199741-20199763 GCCCTGGGGGTGCCCTGGGGTGG + Intergenic
927937736 2:27085066-27085088 GTCCTCGGGCAGCCCTGGGCTGG + Intronic
929441960 2:41971719-41971741 GCCTGAGGTGACCTCTGGGCAGG - Intergenic
929775762 2:44929656-44929678 GACCGAGGGGAGCACTGGCCCGG - Intergenic
929923485 2:46190520-46190542 GTTCCAGGGGAGCGCTGGGCAGG + Intergenic
929935496 2:46291778-46291800 TCCTAAGGGGAGATCTGGGCAGG - Intergenic
930290644 2:49489211-49489233 GGCCTAGGGAAGCTGTAGGCAGG - Intergenic
932221405 2:70002212-70002234 GCCACAGGGTAGCTCTGGACAGG - Intergenic
932593159 2:73079275-73079297 GCCGCAGGGGAGCTGTGGGTGGG - Intronic
934174739 2:89568916-89568938 GCTCCAGGAGAGCCCTGGGCTGG - Intergenic
934285056 2:91643268-91643290 GCTCCAGGAGAGCCCTGGGCTGG - Intergenic
934651321 2:96092721-96092743 GCCCTAGAGGCGCTCTGTGGCGG + Intergenic
934691782 2:96366580-96366602 GTCCAAAGAGAGCTCTGGGCTGG + Intronic
937221674 2:120345929-120345951 GCCCGAGGGGCGCGCCGGGCGGG - Intergenic
938266350 2:129930876-129930898 GCCCCAGGGGACGGCTGGGCTGG + Intergenic
944967729 2:204954603-204954625 GCCTTGGGGGATCTCTGGCCTGG + Intronic
946362850 2:219229444-219229466 GCCCTAAGTGAGCTCGCGGCGGG - Intronic
947237959 2:227963514-227963536 GACATAGGGCAGCTCTGAGCAGG + Intergenic
947611173 2:231526013-231526035 GGCCTTGGGGAGCTGGGGGCTGG - Intronic
948465048 2:238148276-238148298 GCCTTAGGGCAGCAGTGGGCTGG + Intronic
948707843 2:239806290-239806312 GCTCTCGGGGAGCTCTGAGCAGG - Intergenic
948721970 2:239906118-239906140 GACCTTCGGGGGCTCTGGGCGGG + Intronic
1168975999 20:1966303-1966325 CTCCTAGGGGAGCTCTGGAGTGG + Intergenic
1169254339 20:4085675-4085697 GCCCTCGGAGAGCACGGGGCTGG - Intergenic
1171184853 20:23117992-23118014 GGCCCAAGGGAGGTCTGGGCAGG - Intergenic
1173618014 20:44415494-44415516 GGCCCAGGGGTGCTCTGGGCAGG - Intronic
1174322677 20:49754428-49754450 GCATTTGGGGAGCTATGGGCAGG + Intergenic
1175678839 20:60969537-60969559 GCCTCTGGGGAGCTCTGAGCAGG - Intergenic
1175856379 20:62122898-62122920 GCCCTGGGTGGGTTCTGGGCGGG - Intronic
1175937091 20:62518857-62518879 CCCCTTGGGGACCTCGGGGCAGG + Intergenic
1176078448 20:63259825-63259847 TCCCAGTGGGAGCTCTGGGCGGG + Intronic
1176294823 21:5065848-5065870 GCACTAGTGGCACTCTGGGCTGG - Intergenic
1176711612 21:10155018-10155040 GGCCTAGTGGAGCTGTGGGAGGG - Intergenic
1177206619 21:18017740-18017762 TCCCTAGTGGAGCTGTGGGAAGG + Intronic
1177855856 21:26399481-26399503 GCACTAAAGGAGATCTGGGCAGG + Intergenic
1178092899 21:29183268-29183290 GCCCTAGGTCAGCTGTGGCCCGG - Intergenic
1178293721 21:31391121-31391143 GCCCGAGGGCAGCTCTTGGTGGG + Intronic
1179474616 21:41635208-41635230 GCCCTAGAGGGGCACGGGGCTGG - Intergenic
1179862227 21:44196278-44196300 GCACTAGTGGCACTCTGGGCTGG + Intergenic
1180006286 21:45022464-45022486 GGCTGAGGGGAGCTCTGGGCTGG + Intergenic
1180175277 21:46084197-46084219 CCCCTAGTGCAGCTCTGGGGGGG + Intergenic
1182348577 22:29684897-29684919 GCACTAGGGTGGCTCTGGGGTGG + Intronic
1182394972 22:30028656-30028678 GCCTCTGGGGAGCTCTGAGCAGG - Intronic
1183091754 22:35527023-35527045 GCCCTTGGGGAGCACTGTGGAGG - Intergenic
1183404452 22:37623627-37623649 GCCTTAGGTGAGCCCAGGGCAGG + Exonic
1183538739 22:38417666-38417688 GGCAGTGGGGAGCTCTGGGCAGG - Intergenic
1184146538 22:42614738-42614760 GGCCTAGTGGAGCTCGAGGCGGG - Intronic
1184861366 22:47174837-47174859 GCCCTAGCAGGGCGCTGGGCAGG - Exonic
1185010808 22:48312968-48312990 GCCAGGGAGGAGCTCTGGGCAGG + Intergenic
1185045081 22:48524721-48524743 GCCCTGGGGAAGCTCGGTGCAGG - Intronic
1185059109 22:48596769-48596791 GCCCTAGGGCTCCTCTGTGCTGG + Intronic
1185136061 22:49073328-49073350 GCCCCAGGGCAGGTGTGGGCAGG - Intergenic
1185282799 22:49982931-49982953 GGCCTAGGGGAGCTGGGGACGGG + Intergenic
950105220 3:10384334-10384356 GCCCCAGAGGAGCTGAGGGCAGG - Intronic
950123481 3:10497055-10497077 GACCTTGGGCAGCTGTGGGCAGG + Intronic
950193283 3:10992600-10992622 GGCCTGGGGGAGCGCTGGGCGGG + Intergenic
950604324 3:14064868-14064890 GCCCCAGTGCAGCCCTGGGCAGG + Exonic
950633456 3:14299165-14299187 GCCCCAGGGGCTTTCTGGGCTGG - Intergenic
954082316 3:48219843-48219865 CCCCTTGGGGAGCACTGGGGAGG - Intergenic
954360605 3:50120792-50120814 TCCCTAGGGGAGCCATGGCCAGG + Intergenic
954613507 3:51958240-51958262 GGCCAGGGGGAGCTGTGGGCAGG + Exonic
958414190 3:93854553-93854575 TACCTAAGGGATCTCTGGGCAGG + Intergenic
961647059 3:128398210-128398232 GCCCTAGGGGAAGGCTGGGCAGG + Intronic
966760448 3:183413460-183413482 GCCCTGGGGGAGCTGTGAGGAGG - Intronic
967041202 3:185694633-185694655 GTCCTAGGGCAGCTGTGTGCTGG - Intronic
967834384 3:193948657-193948679 GACAATGGGGAGCTCTGGGCAGG - Intergenic
968504433 4:965375-965397 TCCCTTGGGCAGCCCTGGGCTGG - Intronic
968621212 4:1604241-1604263 GCCCTTGGGCAGCCCTGGGTGGG - Intergenic
969568024 4:7991750-7991772 GCCCTGGGGGAGATCCGGGGAGG + Intronic
971397430 4:26241756-26241778 GCACTTTGGGAGGTCTGGGCGGG - Intronic
974587299 4:63896121-63896143 GCTCTAGTGGAGCTCTGTGTGGG + Intergenic
976649876 4:87422891-87422913 GCCCTCGGGGCGCTCATGGCGGG + Exonic
980613992 4:135194661-135194683 GCCCTAGTGGTGCTGTGGGATGG + Intergenic
982291959 4:153790081-153790103 GCCCTCGTGGATCTCTAGGCAGG - Intergenic
985128827 4:186722082-186722104 GCCCTATGGGAGGTCGAGGCGGG - Intronic
985481071 5:111287-111309 TCCCTGGGGCAGCTCTGGCCTGG + Intergenic
985539010 5:479215-479237 GCCCCTGGGGAGGTCAGGGCAGG + Intronic
986411888 5:7489078-7489100 GCCTCAGGAGTGCTCTGGGCAGG - Intronic
986804281 5:11293928-11293950 GCTCTAGACCAGCTCTGGGCTGG - Intronic
988551423 5:32204213-32204235 TCCCTAGGAGAGCCCTGGCCGGG - Intergenic
988787356 5:34577342-34577364 GACCTGTGGTAGCTCTGGGCTGG + Intergenic
989567455 5:42915538-42915560 GCTCTACGGGAGCTCTGCTCCGG + Intergenic
990401098 5:55438291-55438313 GGCCTGCGGGAGCTCAGGGCAGG - Intronic
991292602 5:65047133-65047155 GCCATAAGGGGGCTCTGAGCAGG - Intergenic
992594435 5:78331452-78331474 GCCCTTTGGGAGCTCAAGGCAGG - Intergenic
993722165 5:91332345-91332367 GCCATTGGGGAGCTGTTGGCTGG + Intergenic
997303684 5:132823948-132823970 GCCCAGGGGTGGCTCTGGGCTGG + Exonic
997575839 5:134976601-134976623 TGCCTAGTGGAGCTCTGGGAAGG - Intronic
997713853 5:136028244-136028266 GCCCTGGAGGAGCTCAAGGCAGG - Intergenic
997849218 5:137315877-137315899 GTCCTAGGGGAGTTGGGGGCAGG + Intronic
1001683468 5:173575662-173575684 GTGATAGGGGAGCTCTGGGCAGG + Intergenic
1001959163 5:175870029-175870051 GCCTGAGGGGAATTCTGGGCAGG - Intronic
1002176443 5:177403825-177403847 CCCCTGGGGCGGCTCTGGGCGGG + Intronic
1002440883 5:179263834-179263856 GCCCTGAAGGAGCTCTGAGCGGG - Intronic
1002525484 5:179813369-179813391 GCCCTGGGGCAGACCTGGGCAGG + Intronic
1002683724 5:180990483-180990505 GCCCCAGCGGAGCTCCGTGCTGG - Intronic
1003040732 6:2685255-2685277 GCCCTTGGGGAGGTCAGGGAGGG + Intronic
1003194127 6:3899837-3899859 ACGCTTGGGGAGCTCTAGGCAGG + Intergenic
1003608780 6:7590182-7590204 GGCCTCTGGGAGCTGTGGGCGGG - Exonic
1004023010 6:11791338-11791360 GCCCTGGGGGAGCTGTGCGGAGG - Intronic
1006502891 6:34469391-34469413 ACCGGAGGGGAGGTCTGGGCTGG + Intronic
1006825776 6:36934742-36934764 GCACTTTGGGAGGTCTGGGCGGG + Intergenic
1007230386 6:40343954-40343976 GCTCTAGGTGAGCTGTGGCCTGG + Intergenic
1011513406 6:88126274-88126296 GACCTGTGGCAGCTCTGGGCAGG - Intergenic
1015369993 6:132439750-132439772 GCCCTAGGGCAGCACAGGCCAGG - Intergenic
1015402110 6:132798603-132798625 GGCTTTGGGGAGCTCCGGGCCGG - Intergenic
1017135197 6:151141891-151141913 GCCCTATGGGAACACGGGGCAGG + Intergenic
1017146589 6:151240607-151240629 GCCCGAGGGGAGCTCCACGCCGG + Exonic
1017154468 6:151310495-151310517 GCCCTTGGGGAGGTCGAGGCTGG + Intronic
1019309495 7:353249-353271 GCCCTTGGGAAGCTCTGAGTGGG + Intergenic
1019309599 7:353607-353629 GCCCTTGGGAAGCTCTGAGTGGG + Intergenic
1019523402 7:1470401-1470423 GCCCTGGGGTGGCTCCGGGCCGG - Exonic
1019539756 7:1546351-1546373 GCCACAGGGGAGCCCTGGCCAGG - Exonic
1019570323 7:1708431-1708453 GCCCAAGCGCAGCTCTGTGCTGG - Intronic
1019601328 7:1885250-1885272 CCCTTCGTGGAGCTCTGGGCAGG - Intronic
1019646368 7:2131545-2131567 GTCCCAGGGGACCTCTGCGCAGG + Intronic
1019914390 7:4123456-4123478 ACCCTATGGGAGCTCTGTGCAGG + Intronic
1022197704 7:28084709-28084731 GCCTTGGAGCAGCTCTGGGCAGG + Intronic
1022471814 7:30686276-30686298 GCCCTTGGGGAGGCATGGGCTGG - Intronic
1022519335 7:30995856-30995878 GCCTGAGGGGAGACCTGGGCTGG - Intergenic
1023048917 7:36234919-36234941 GCCATGGGGGAGGCCTGGGCTGG - Intronic
1023048954 7:36235019-36235041 GCTGTAGGGGAGGCCTGGGCTGG - Intronic
1023048987 7:36235119-36235141 GCTGTAGGGGAGGCCTGGGCTGG - Intronic
1023048996 7:36235144-36235166 GCTGTAGGGGAGGCCTGGGCTGG - Intronic
1024530722 7:50390250-50390272 GACCTCTGGGAGCCCTGGGCAGG + Intronic
1029604401 7:101590054-101590076 CCCCCAGGGGAGCTATGGACAGG + Intergenic
1033287829 7:140057787-140057809 GCCCTTGGTGATCTCTGGTCTGG - Intronic
1035276741 7:157752444-157752466 ACCCCAGGGGAGCTCTGGCCTGG - Intronic
1036215732 8:6878242-6878264 GCCACAGGGAAGCTCTGAGCAGG + Intergenic
1036790327 8:11713493-11713515 GCCCTAGGGGAACGGTGGGCAGG + Intronic
1038535330 8:28349362-28349384 AGCCGAGGGGAGCTCTTGGCAGG + Intronic
1038942657 8:32322680-32322702 GCCCTGGGGTAGCTCAGGACAGG + Intronic
1039794401 8:40899994-40900016 GCCCCAGGGGAGGCCAGGGCAGG - Intergenic
1040315912 8:46260827-46260849 TCCCCAGGGGTGTTCTGGGCAGG + Intergenic
1040333269 8:46403202-46403224 GCCCCAGGGCTGCCCTGGGCAGG + Intergenic
1040888809 8:52294129-52294151 GCCCTGGGGAAGCTCTGGTTAGG - Intronic
1042129293 8:65571195-65571217 GCACTTTGGGAGGTCTGGGCGGG - Intergenic
1047299051 8:123597224-123597246 GTTCTAGGGGAGCTCAGGTCAGG + Intergenic
1049354659 8:142181831-142181853 GCCCTCCGAGAGCTCTGGGACGG - Intergenic
1049805581 8:144537307-144537329 GCCCAGGGGCAGCCCTGGGCGGG + Intronic
1050092056 9:2025267-2025289 GCCCTCGGGGAGTCCTGGTCTGG + Intronic
1052351122 9:27459199-27459221 GTCCCAAGGGGGCTCTGGGCTGG - Intronic
1053152879 9:35754104-35754126 GCCCTAAGGATGCTCTGGGCTGG - Exonic
1055800716 9:80032734-80032756 TGCCTAGTGGAGCTCTGGGAAGG - Intergenic
1056763192 9:89428866-89428888 GCCCTAGAGAAGCTTTGCGCTGG - Intronic
1057035813 9:91811142-91811164 GGCCTAGGGGAGGTGTGGGAAGG - Intronic
1059497251 9:114720080-114720102 TCCCTAGGGGAGCCCAAGGCAGG + Intergenic
1060215716 9:121737195-121737217 GCCCTCTGGGGCCTCTGGGCAGG - Intronic
1060396320 9:123319297-123319319 GCCAGAGGGGAGGTCTGGCCAGG + Intergenic
1061035879 9:128114159-128114181 GCTCCAGGGGAGCCCTGGGGCGG + Intergenic
1061053093 9:128207501-128207523 GCCCTAGAGGAGCACTGGGGTGG - Intronic
1061218916 9:129237619-129237641 TCCCTGGGGGAGCTCTTTGCAGG + Intergenic
1061258189 9:129464973-129464995 CCCCAAGGTGGGCTCTGGGCTGG - Intergenic
1061974656 9:134062117-134062139 GCCCTGGAGGAGCCCTGGGGAGG + Intronic
1062277732 9:135738711-135738733 GTGTTAGGGGAGCTCTGGGCAGG - Intronic
1062396748 9:136355681-136355703 GCCCTCGGGATGCTCTGGGGAGG - Exonic
1062444796 9:136589090-136589112 GTCCCAGGGCAGCTCTGAGCAGG + Intergenic
1062461410 9:136664046-136664068 GGCCTAGGGGGCCTCTGGGTGGG - Intronic
1202796367 9_KI270719v1_random:124007-124029 GGCCTAGTGGAGCTGTGGGAGGG - Intergenic
1190114853 X:47619750-47619772 GTCCTAGGGGTGGTCTGGCCAGG + Exonic
1191959150 X:66680345-66680367 GCCCTTCAGGAGCACTGGGCTGG - Intergenic
1200134403 X:153867896-153867918 ACCCTCAGGGAGCCCTGGGCCGG - Exonic
1200253726 X:154568192-154568214 GCCCTAGGTGAGCGCTCTGCTGG + Intergenic
1200264043 X:154636216-154636238 GCCCTAGGTGAGCGCTCTGCTGG - Intergenic
1200873598 Y:8128592-8128614 GCCGTGGGGGAGCTCCCGGCGGG + Intergenic
1201457533 Y:14186365-14186387 GCCCTCTGGGAGCCCAGGGCAGG + Intergenic