ID: 905827701

View in Genome Browser
Species Human (GRCh38)
Location 1:41038741-41038763
Sequence CCTCATCTGCAGAAGGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 465
Summary {0: 1, 1: 0, 2: 7, 3: 41, 4: 416}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905827701_905827709 15 Left 905827701 1:41038741-41038763 CCCACCTCCTTCTGCAGATGAGG 0: 1
1: 0
2: 7
3: 41
4: 416
Right 905827709 1:41038779-41038801 TTCCAGGAAAAATGACTAACAGG 0: 1
1: 0
2: 1
3: 24
4: 369
905827701_905827710 16 Left 905827701 1:41038741-41038763 CCCACCTCCTTCTGCAGATGAGG 0: 1
1: 0
2: 7
3: 41
4: 416
Right 905827710 1:41038780-41038802 TCCAGGAAAAATGACTAACAGGG 0: 1
1: 0
2: 0
3: 38
4: 285
905827701_905827707 -1 Left 905827701 1:41038741-41038763 CCCACCTCCTTCTGCAGATGAGG 0: 1
1: 0
2: 7
3: 41
4: 416
Right 905827707 1:41038763-41038785 GGTTCTGTCTCCTATTTTCCAGG 0: 1
1: 0
2: 2
3: 21
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905827701 Original CRISPR CCTCATCTGCAGAAGGAGGT GGG (reversed) Intronic
900457157 1:2782759-2782781 CCTCCTCTGTAAAAGGAGGAGGG - Intronic
900507760 1:3038254-3038276 ACTGATGTGCAGACGGAGGTAGG - Intergenic
903330633 1:22595306-22595328 GCTCATCTGCAAGAAGAGGTGGG + Exonic
903808915 1:26023546-26023568 CCTCAGCTGCAGCAGCAGGAGGG + Intronic
903972770 1:27129878-27129900 CCTCAGCTGTAGAATGAGGAGGG - Intronic
904005164 1:27359813-27359835 CCTCATCTGCTGAGGGTGGCGGG - Intronic
904684394 1:32250109-32250131 CCTCAGCTGCAGAGAGAAGTGGG - Intergenic
904756091 1:32769765-32769787 CAGCATGTGCAGAAGGAGCTTGG + Exonic
904789641 1:33009605-33009627 CCTCAGCTGAAAAAGGAAGTTGG - Intronic
905175587 1:36133561-36133583 CCTCATCTGCAGATAGTAGTAGG + Intergenic
905270914 1:36786896-36786918 CCTCATCTGGAAAATGGGGTTGG - Intergenic
905276144 1:36819451-36819473 CCTCAGCTGGAGCAGGAGGTGGG + Intronic
905562080 1:38935489-38935511 CATCATCTGTAAAAGGAGGGTGG + Intronic
905827701 1:41038741-41038763 CCTCATCTGCAGAAGGAGGTGGG - Intronic
906533009 1:46534133-46534155 CTTCATCTGAATAAGGGGGTGGG - Intergenic
907137493 1:52153598-52153620 CCTCATCCTCAGGAGGAAGTAGG - Intronic
907362711 1:53932678-53932700 CCTCAGCTCCAAAAGGAGCTGGG + Intronic
907738554 1:57140327-57140349 CCTCATCTGTAGAATGAGGGAGG - Intronic
912963381 1:114215930-114215952 CCTCTCCTGCAGGAGGAGATAGG - Intergenic
913329305 1:117654001-117654023 CCTCCTCTGTAGTAGGAAGTAGG + Intergenic
915364690 1:155308425-155308447 CCTCATCTGTTGAATGAGGGTGG - Intergenic
916016846 1:160757342-160757364 GCTGATCTGGAAAAGGAGGTGGG + Intergenic
916314116 1:163428436-163428458 TCTCAACTGGAGAAGGAGGAGGG + Intergenic
917118655 1:171626562-171626584 CCTCAGCTGGAGAAGGAGGTGGG - Intergenic
917581121 1:176378938-176378960 ACTCATCACCAGAAGAAGGTTGG - Intergenic
919371867 1:196738644-196738666 CCACATCTGCACAAGGCTGTGGG - Intronic
919535988 1:198788583-198788605 CCTCAGCTACAGAGAGAGGTAGG - Intergenic
921005751 1:211091726-211091748 CTTCATCCACAGAAGGAGGTAGG + Intronic
922765872 1:228156591-228156613 CCTCAGCTGCATAAAGAGGCCGG + Intronic
923070547 1:230560601-230560623 CATGCTCTGCAGAAGGGGGTAGG - Intergenic
923166068 1:231363413-231363435 CCTCTGCTGCAAAAGGAAGTGGG - Intergenic
923976534 1:239270726-239270748 CCTGATCAGGAGAAGGAGGTAGG - Intergenic
1062813887 10:485230-485252 CCTCATGTGCTGCAGAAGGTGGG - Intronic
1064724814 10:18268066-18268088 ACTCAGATGCAGAGGGAGGTGGG - Intronic
1064893349 10:20205789-20205811 CCTCATCTGTAAGATGAGGTGGG - Intronic
1066134887 10:32435344-32435366 CCTCATCCTCACAAGTAGGTGGG - Intergenic
1066566733 10:36729180-36729202 CCTGATTAGCAGGAGGAGGTAGG - Intergenic
1067708972 10:48633767-48633789 ATCCATCTGCAGAAGGAGATGGG + Intronic
1067944044 10:50679392-50679414 CCTCATCTGGACAAAGACGTTGG - Intergenic
1070312124 10:75281556-75281578 CCCCAGCTGCAGATGGAGGTGGG + Intergenic
1070626466 10:78054514-78054536 CCTCATCTGCAAAAGCGGGAAGG - Exonic
1070865536 10:79706261-79706283 CCTCATCTGGACAAAGACGTTGG - Exonic
1070879329 10:79844392-79844414 CCTCATCTGGACAAAGACGTTGG - Exonic
1071400282 10:85261955-85261977 CCTCATTTGCAAAATAAGGTAGG + Intergenic
1071632437 10:87228482-87228504 CCTCATCTGGACAAAGACGTTGG - Exonic
1071645888 10:87360700-87360722 CCTCATCTGGACAAAGACGTTGG - Exonic
1073727539 10:106251474-106251496 CCTCAACCGCAGATGGAGTTAGG - Intergenic
1074601366 10:114917164-114917186 CCTCATTTCCAGCAGGAGGAAGG + Intergenic
1075551275 10:123394505-123394527 CCTCATCTGGGGAACGAGGTTGG + Intergenic
1075596058 10:123730012-123730034 CCTCATCTGCAGAGGAAAGGTGG - Intronic
1075739087 10:124682511-124682533 TCTCATCTGTAAAATGAGGTTGG - Intronic
1075925441 10:126248128-126248150 CCTCATCTGCAGATTGAGTGTGG + Intronic
1076403214 10:130196646-130196668 CCTCAGCTGCAGAAGGTTGCAGG + Intergenic
1077747448 11:4923180-4923202 CCTCAACTGCAGAATGAGCAAGG - Intronic
1077781447 11:5334295-5334317 CCTCCTTTGGAGAAGGAAGTGGG + Intronic
1078427249 11:11261870-11261892 CCCCAGCTGCAGATGCAGGTAGG + Intergenic
1078779126 11:14420577-14420599 CCTCATCTGTAGAACAAGGATGG + Intergenic
1079141341 11:17812056-17812078 CCCCTTCTGCAGATGGAGGGGGG - Intronic
1079318132 11:19427220-19427242 CCTCCCCTGCAGAAAGAGGATGG + Intronic
1079806991 11:24944290-24944312 CCTCATCTGAATACTGAGGTTGG - Intronic
1080036337 11:27715791-27715813 CCTCATCTGTAAAAGGTGATTGG + Intronic
1081354583 11:42096501-42096523 CCTCCTCTGTAAAATGAGGTGGG + Intergenic
1083119856 11:60500898-60500920 ACACATCTGAAGCAGGAGGTGGG - Intronic
1083166711 11:60892978-60893000 CCTGAACTGCAGAAGGGAGTAGG - Intronic
1083641725 11:64149309-64149331 CCTCCTCTGCAAAATGAGGGTGG - Intronic
1083769314 11:64857553-64857575 CCTCATCTACAGGGTGAGGTGGG + Intronic
1083924993 11:65800694-65800716 CCTCATCTATAAAATGAGGTGGG + Intergenic
1085260793 11:75203593-75203615 CCTCATCTATAAAAGGAGGGGGG - Intronic
1085620335 11:78033036-78033058 CCTCATCTGCAAAATGAGGAGGG + Intronic
1085770350 11:79320007-79320029 CCTCCACTGCAGTAGAAGGTAGG - Intronic
1086455536 11:86955696-86955718 TCTCACCTGCAGAAGGGGGCAGG - Intergenic
1086931609 11:92699710-92699732 TATCATCTGCAGAGGGAAGTAGG + Intronic
1087965064 11:104402959-104402981 GCTGATTAGCAGAAGGAGGTGGG - Intergenic
1088672929 11:112161293-112161315 CCTCATTTGGACAAGGAAGTTGG + Intronic
1089810354 11:121126336-121126358 CCTCATCTGCAGCAGCAGCAGGG - Intronic
1090433017 11:126662526-126662548 CCTTATATGCAGAAGGTGGAAGG + Intronic
1091057794 11:132435154-132435176 CCTCATCAGCAGTGGCAGGTGGG - Intronic
1091071672 11:132570433-132570455 CCTCATCTTCAGGAGCAGGCAGG + Intronic
1092065539 12:5587390-5587412 CCTCCTGAGCAGAAGGATGTAGG - Intronic
1093493030 12:19726162-19726184 GCTCCTGGGCAGAAGGAGGTGGG - Intergenic
1096290262 12:50336282-50336304 CCTCTTCTGTAGAATGAGGATGG - Intronic
1096792471 12:54053610-54053632 CCTCCCCTGCAAAAGGAGATGGG - Intronic
1096794935 12:54070819-54070841 CCTCATCTGAGGCTGGAGGTGGG + Intergenic
1097059866 12:56274838-56274860 ACACAGCTGCAGAAGGAAGTTGG - Exonic
1098999448 12:77160926-77160948 TCTCATTTGTAGAAGGAAGTGGG - Intergenic
1100744349 12:97629108-97629130 CCTCATTTGCAAAAGGAGACTGG - Intergenic
1101136341 12:101747654-101747676 CTTCATCTGTAGGAGGAGGCAGG + Intronic
1101785038 12:107875111-107875133 CCTAATCTGCAGAAGGTAGCTGG + Intergenic
1101815898 12:108146012-108146034 CCTCGACTGGAGAAGGAGGGGGG + Intronic
1101885477 12:108657557-108657579 CCTCATCTGGGGAAGGGGGATGG - Intronic
1102131978 12:110538750-110538772 CCTCATCTGCAAAACGGGGATGG + Intronic
1102799826 12:115722427-115722449 CCTAATCTGTAGAAGAAGGTAGG - Intergenic
1103140749 12:118545953-118545975 TCCACTCTGCAGAAGGAGGTGGG + Intergenic
1103141165 12:118549619-118549641 TCGACTCTGCAGAAGGAGGTGGG + Intergenic
1103723807 12:122988165-122988187 CCTCATCTGGACACGGAGGCTGG + Intronic
1104276863 12:127337003-127337025 CCACCTCTGCAGCTGGAGGTGGG - Intergenic
1104477757 12:129084492-129084514 CATCGTCTCCAGCAGGAGGTGGG - Exonic
1104493780 12:129217871-129217893 CCTCTTATACAAAAGGAGGTAGG - Intronic
1104857856 12:131910237-131910259 ACTCATCTGCAGGAGGAAGGAGG - Exonic
1105019687 12:132807883-132807905 CAGCATCTGCAGCAGGTGGTGGG - Exonic
1106656464 13:31752243-31752265 AGTCATCTGAAGAAGGAGGGGGG + Intronic
1106676270 13:31961833-31961855 CATCCTCTGCAGAAGGCAGTTGG + Intergenic
1107903546 13:45041760-45041782 CCTCATCTGCCCAAGTAGCTGGG - Intergenic
1107998820 13:45888157-45888179 CCTCATCTGCAAAAGAGGGATGG - Intergenic
1108005410 13:45941425-45941447 CCCCAGCTGCAGAGGGAGGCTGG - Intergenic
1108460852 13:50665996-50666018 CCTGATCACCAGTAGGAGGTAGG + Intronic
1108729038 13:53213823-53213845 CGTCATAGGCAGAAGGAGGAAGG - Intergenic
1111769410 13:92578108-92578130 CCTCTACTGCAAAAGGAGCTAGG - Intronic
1113923807 13:113929369-113929391 CCACATGTGCAGCGGGAGGTGGG - Intergenic
1116617013 14:47153170-47153192 TCTCTTCTCCAGAAGGAGCTAGG - Intronic
1118037149 14:61880060-61880082 TTTCATCTGCAGACAGAGGTGGG - Intergenic
1119033016 14:71207164-71207186 CCTCTTTTGCACGAGGAGGTAGG - Intergenic
1120514331 14:85452400-85452422 CCTTATCTGCAGAATGGGGGTGG + Intergenic
1122267987 14:100555546-100555568 CCTCATCTGGAAAACGGGGTGGG - Intronic
1123389282 15:19853355-19853377 CCTGATTAGCAGGAGGAGGTAGG - Intergenic
1124439281 15:29675039-29675061 CCAGAGCTGCAGCAGGAGGTCGG - Intergenic
1124455108 15:29835021-29835043 CCTCATCTGCAGAATGGAGGAGG + Intronic
1126787744 15:52191847-52191869 CCTCATCAGCAGTAGGATGAAGG + Intergenic
1126928176 15:53614764-53614786 CCTCATTTACAAAATGAGGTGGG - Intronic
1127282361 15:57503227-57503249 CCTCATCAGGAGTAGGAGGAAGG - Intronic
1127310097 15:57744853-57744875 CCACATCTGCAGAATGGGGCTGG - Intronic
1127965844 15:63922448-63922470 CCCCTTCTGCAGAGGGAGGATGG - Intronic
1128114380 15:65096133-65096155 CTTCACCTTCAGAAGGAGGGCGG + Intronic
1128323392 15:66707560-66707582 CCTCACCTCCAGGAGGAGCTAGG - Intronic
1128862306 15:71084095-71084117 TCTCAACTGTAGAAGGAGGTGGG + Intergenic
1128890646 15:71328920-71328942 CCTGATCTGTAGAATGAGGCTGG + Intronic
1129052765 15:72796742-72796764 CCCCATCTGCAGAATGGGGATGG + Intergenic
1131072429 15:89474660-89474682 CCTCAACTGCTGAAAGGGGTGGG + Intronic
1131515918 15:93076710-93076732 CTTCATCTGCAAAATGAGGATGG - Intronic
1131737574 15:95350144-95350166 CCTCATCTGGAAAATGAGGAGGG + Intergenic
1131829139 15:96343349-96343371 CCTCCTCTCAAGCAGGAGGTTGG - Intergenic
1131838457 15:96413027-96413049 ACTCCTCTAAAGAAGGAGGTTGG + Intergenic
1131946278 15:97625634-97625656 AGTCAGCTGCAGATGGAGGTAGG + Intergenic
1132329856 15:101004735-101004757 CCTGAACTGCAGAAGGAGCAGGG - Intronic
1132406319 15:101543561-101543583 CCTCAGCTGTAGAAGGACGAGGG - Intergenic
1133378577 16:5310515-5310537 CCTCATCTGTATATGGAGGAGGG + Intergenic
1133463981 16:6012202-6012224 CCTCATCTGTAGAATGAGGATGG + Intergenic
1133728655 16:8559760-8559782 CATCATCAGCAGAACGAAGTCGG - Intergenic
1133872795 16:9705227-9705249 CCTCATCTGTAAAAGGCGGATGG - Intergenic
1134095600 16:11416446-11416468 CCTCATCTGCAGAATGGGAATGG + Intronic
1134859247 16:17546342-17546364 CTTCATCTGCAGAAGTAGACGGG - Intergenic
1135400627 16:22164045-22164067 CCTCAGGTGGAGAGGGAGGTCGG + Intergenic
1136224133 16:28847138-28847160 CCTCATCTGCAAAATTAGATGGG - Intronic
1136287191 16:29251493-29251515 GCCCTTCTGCAGAAGGAGCTCGG - Intergenic
1136549123 16:30972942-30972964 GCACATCTGCAGGAGGAGGAAGG + Intronic
1137619799 16:49868661-49868683 CCTTGTCTGAAGCAGGAGGTGGG + Intergenic
1138724378 16:59119898-59119920 CCTGATCAGCAAGAGGAGGTAGG - Intergenic
1139021540 16:62755997-62756019 CCCCATGTGCAGAGGGAGGGAGG + Intergenic
1139188676 16:64836723-64836745 CCTGATCAGCAGGAGGAGGCGGG - Intergenic
1139681818 16:68570938-68570960 CCTCAGATGCTGAAGGAGCTGGG + Intronic
1141188043 16:81802521-81802543 CCTCATCAAGAGAAGGTGGTAGG - Intronic
1141618386 16:85222821-85222843 CCTCCTCTGCAGCAGAAGTTTGG + Intergenic
1141685904 16:85569893-85569915 CCTCATCTCCACACAGAGGTGGG - Intergenic
1141735557 16:85850050-85850072 CCTCATCTGCAGAACAGAGTCGG + Intergenic
1142092801 16:88224126-88224148 GCCCTTCTGCAGAAGGAGCTCGG - Intergenic
1144191821 17:12853400-12853422 CCTGATCTACAGAAGGAGGTGGG + Intronic
1144848713 17:18233374-18233396 CCCCATCTGCAGAAGCTGGGAGG - Intronic
1145000659 17:19302290-19302312 TCTCATCTGCAGAATGGGGACGG - Intronic
1145249315 17:21288681-21288703 CCTCATCTGCAGACTGAGAATGG + Intronic
1146091893 17:29887557-29887579 CCTCATCTGTAAAATGAGGATGG + Intronic
1146264769 17:31445118-31445140 CACCATCTGCAGCAGGAGCTTGG - Intronic
1148263054 17:46201025-46201047 CCTCAGCTGCCCAAGTAGGTGGG + Intronic
1148845465 17:50527387-50527409 CCACATCTGGTGCAGGAGGTTGG - Exonic
1149948552 17:60959189-60959211 CCTCAGCTTCCCAAGGAGGTGGG - Intronic
1150187072 17:63194013-63194035 CCTCATCTACAGATGGAGGGGGG - Exonic
1151285153 17:73105595-73105617 CCCCATGTGCAGAAGGAACTGGG - Intergenic
1152690236 17:81714664-81714686 CCTCATCTGCAGAAGGAGAATGG + Intronic
1152851099 17:82636507-82636529 CCTCTTCAGCTGCAGGAGGTGGG - Intronic
1152997660 18:423151-423173 CCTCATCTTCCCAAGGAGCTAGG - Intronic
1153135673 18:1914691-1914713 CAGCAGCTGCACAAGGAGGTGGG + Intergenic
1153428813 18:4993087-4993109 GCTCCTAGGCAGAAGGAGGTGGG - Intergenic
1154532598 18:15362757-15362779 CCTGATTAGCAGGAGGAGGTAGG + Intergenic
1154999832 18:21675240-21675262 CCTCATCTGTGGAATGAGGTGGG + Intronic
1156384703 18:36594584-36594606 CCTCATCTGCACAATGGGGATGG + Intronic
1156624040 18:38886990-38887012 CCTCATCTCCACAAGGGGCTGGG - Intergenic
1157514371 18:48300460-48300482 CCTCAGCTGCAAAATGAGGGTGG - Intronic
1157574173 18:48732647-48732669 CCTCATGTCCAGAAGGAGCTGGG - Intronic
1160021376 18:75184315-75184337 CCTCATTTACACAAGGAGGGAGG + Intergenic
1161062310 19:2221446-2221468 CCTCATTGGCAGAAGCAGGGAGG + Intronic
1161249159 19:3271135-3271157 CCTCATCTGCCCAAGGTGCTGGG + Intronic
1161475515 19:4482771-4482793 CCTCATCTGCAGAATCAGGCTGG + Intronic
1162918963 19:13889289-13889311 CCTGGTCTGCAGAATGAGGCAGG + Exonic
1163132045 19:15280368-15280390 CCTTCTCTGCAGAAGCAGCTGGG + Exonic
1163562970 19:18031565-18031587 ACACAGCTGCAGAAGGAAGTTGG + Intergenic
1163762199 19:19143581-19143603 CCTCATCCTTAGAAGGAAGTTGG - Intergenic
1164596510 19:29533879-29533901 CCTGAGCTGCAGAGGGAGCTCGG + Intronic
1165123986 19:33581149-33581171 TCTCATCTGCAAAGTGAGGTGGG + Intergenic
1165299354 19:34958781-34958803 CCTCTTATGCTGAATGAGGTTGG + Exonic
1166552664 19:43676725-43676747 CCTCAGCTGCCCAAGCAGGTGGG + Intergenic
1166775067 19:45307468-45307490 CCTCTTCTGCAGACGCAGGCGGG + Exonic
1166863213 19:45821480-45821502 CCTCACCTGCAGCAGGCGGGAGG + Exonic
1167105280 19:47426814-47426836 ACTGATCTGCAGTGGGAGGTGGG - Intergenic
1167339503 19:48906606-48906628 CCTCAGCTTCCTAAGGAGGTGGG - Intronic
1168318020 19:55492563-55492585 CCTCATCTGCAGACAGGGGAGGG - Intronic
1168467795 19:56618283-56618305 CCTCATCAGCAAAATGAGGATGG + Intronic
1202635640 1_KI270706v1_random:41567-41589 CCTCAGCTGCACAAGGAAGCAGG - Intergenic
925195002 2:1915595-1915617 CCTCATCTGCAAAGTGAGGCAGG - Intronic
925695252 2:6570008-6570030 CCTCATCTGCACAGTAAGGTAGG - Intergenic
925912942 2:8584863-8584885 CTTCACCTGCAGGAGGAGCTGGG - Intergenic
926247589 2:11132533-11132555 CCTCATCTGTAGAATGGCGTTGG + Intergenic
929611949 2:43277221-43277243 CATTACCTGCAGAAGGAGATCGG + Intronic
930007242 2:46907805-46907827 ACTCATGTCCATAAGGAGGTAGG - Exonic
930020881 2:47001464-47001486 CCTCATCTGCAGAGGGTGGGGGG + Intronic
930853832 2:55990825-55990847 CCACAACTGCACAGGGAGGTGGG + Intergenic
931284238 2:60819174-60819196 CCTCATCTGCAGAACAGGGCTGG - Intergenic
932266385 2:70370753-70370775 CCTCATCTGTAGAGTGAGGATGG + Intergenic
932639483 2:73429067-73429089 CCTGATCTGCATAAGGAAATAGG + Intronic
933471913 2:82736249-82736271 CCTCAGCTGAAGAAGAAGGCGGG - Intergenic
934315329 2:91913015-91913037 CCTCAACTGCACAAGTAGTTGGG - Intergenic
934771482 2:96910341-96910363 CCTCCTCTGCACAGTGAGGTTGG + Intronic
935129404 2:100250071-100250093 CCCCATCTGCAAAATGAGGAGGG + Intergenic
935304316 2:101721968-101721990 CATCAGCTGCAGCAGGAGTTAGG - Intronic
935921678 2:108022340-108022362 CCTGGTCATCAGAAGGAGGTGGG + Intergenic
936051994 2:109230949-109230971 ACTCATTTGCAGTAGGAGTTGGG + Intronic
936675352 2:114708228-114708250 CCTCAGCTGCAGTATGAAGTGGG - Intronic
937215501 2:120310262-120310284 CCTCATCTGTAAAATGAGGGGGG + Intergenic
937476582 2:122220496-122220518 TATCATCTGCTGAAGGAGGAGGG - Intergenic
938531702 2:132193978-132194000 CCTGATTAGCAGGAGGAGGTAGG + Intronic
945967251 2:216201707-216201729 TCTCTTCTGCAGAAAGGGGTAGG - Intronic
947837368 2:233185274-233185296 CCTCAGTTGGAGAAGGAGGCAGG - Intronic
948243251 2:236456269-236456291 CCTCATCTTAAAAATGAGGTAGG - Intronic
948632812 2:239312872-239312894 CTTCATCTGCAGAGGGAGACCGG + Intronic
948794928 2:240397628-240397650 CCTCGTCTGTAGAAAGGGGTTGG - Intergenic
1168816715 20:742849-742871 CCTCCTCTACAGAGGGAGGAAGG - Intergenic
1168826588 20:818447-818469 CCTCATCTGTAGAATGAGTGAGG + Intergenic
1168851440 20:979750-979772 CCCCAAATGCAGAAGGAGCTGGG - Intronic
1168927061 20:1590527-1590549 CCTCGCCTGTAAAAGGAGGTAGG - Intronic
1170485622 20:16813039-16813061 ACCCAGCTGCAGAAGGAGGTAGG - Intergenic
1170534297 20:17324808-17324830 CAGCATCTGCAGAAGGAAATGGG + Intronic
1170562581 20:17569933-17569955 CCTCATCTGCTGAAGGCTGCGGG - Exonic
1170661677 20:18347480-18347502 TTTCCTCTGGAGAAGGAGGTAGG - Intergenic
1172660139 20:36562413-36562435 CCTCAGCTGCAGGAGTAGCTGGG - Intergenic
1173054422 20:39597479-39597501 CAACATCTGCAAAAGGGGGTTGG - Intergenic
1173339019 20:42137392-42137414 CATCTTTTCCAGAAGGAGGTGGG - Intronic
1173640742 20:44600236-44600258 GCTCATCTGCAGAGGCAGGCAGG + Intronic
1174520986 20:51130474-51130496 CCTCATCTGAAGAAGGGGGTCGG + Intergenic
1174706811 20:52664751-52664773 TCTCATCTGCAAGATGAGGTGGG - Intergenic
1175127160 20:56760910-56760932 CATCAGCTGCCGAAGGAGGAAGG - Intergenic
1175470007 20:59220933-59220955 CCTCATCTGTAGAATGGGGCTGG + Intronic
1175874751 20:62224098-62224120 CCTGATCAGCAGGAGAAGGTGGG + Intergenic
1176764760 21:13005452-13005474 CCTGATTAGCAGGAGGAGGTAGG - Intergenic
1177627827 21:23687183-23687205 CCTCTTCTTCATAAGGTGGTGGG + Intergenic
1178151533 21:29799997-29800019 TCTCATTTGCAGAAGAAGTTCGG - Intronic
1178351193 21:31873857-31873879 CCTCATCGGCAGCAGGAAGCTGG + Exonic
1178467104 21:32858787-32858809 GCTCCTGGGCAGAAGGAGGTGGG - Intergenic
1178704522 21:34862215-34862237 CCTCATCAGCAAAATGAGGGGGG + Intronic
1179170039 21:38965912-38965934 CCTCATTTGCAGAAACAGGTGGG - Intergenic
1179396938 21:41049061-41049083 CCTCTTCTGCTGAATGAGATGGG + Intergenic
1179521120 21:41945649-41945671 CCTCACCTGCAGAGGGAGGGAGG + Intronic
1179967600 21:44816499-44816521 CCTCATCTGTAAAGGGAGGGTGG + Intronic
1180106595 21:45622858-45622880 CCTCATCTGCAGGAGGACACTGG - Intergenic
1180478623 22:15733162-15733184 CCTCAGCTACACAAGGAAGTGGG + Intergenic
1180511945 22:16100245-16100267 CCTGATTAGCAGGAGGAGGTAGG - Intergenic
1180799736 22:18626174-18626196 CCTCATCTGCTCAAGAAGGGAGG - Intergenic
1181221979 22:21369092-21369114 CCTCATCTGCTCAAGAAGGGAGG + Intergenic
1181549124 22:23626674-23626696 CCTCACCTGCAGTAGGAGGCTGG - Intronic
1181637368 22:24180731-24180753 CCTCATCTGCTCAAGAAGGGAGG + Intergenic
1181799541 22:25335489-25335511 CCTCACCTGCAGTAGGAGGCTGG + Intergenic
1181943424 22:26496716-26496738 CCCAAGCTGCAAAAGGAGGTGGG - Exonic
1182055003 22:27345644-27345666 CCTCAACTGGAGAAGGAAGAGGG - Intergenic
1182068722 22:27448266-27448288 CCTCATCTGCAGACTGAGCAGGG + Intergenic
1182080138 22:27522956-27522978 GGTTATCTGGAGAAGGAGGTGGG + Intergenic
1182096055 22:27626808-27626830 CCTCATCTGCAAAATGGAGTTGG - Intergenic
1182412058 22:30195654-30195676 CCTCATCTACAAAATGAGATTGG - Intergenic
1182413481 22:30206121-30206143 CCTCATCTGTAAATGGAGGCGGG - Intergenic
1182823786 22:33244373-33244395 CCTCATCTGCACAATGGGGATGG - Intronic
1183456189 22:37924609-37924631 CTTCATGGGCAGCAGGAGGTGGG - Intronic
1183747006 22:39697852-39697874 CCTCATTCGCAGAAGCAGGAAGG - Intergenic
1184027460 22:41868484-41868506 CATCATCTTCAGCAGTAGGTGGG + Intronic
1184272636 22:43393389-43393411 CCTCTTCAGCAGAAAGAGGCCGG - Intergenic
1184340722 22:43884438-43884460 CTTCATCTGCAGAAGGTGGAGGG - Intronic
1184495343 22:44837906-44837928 TCTCATCTGCCTGAGGAGGTTGG + Intronic
1184568775 22:45309600-45309622 CCTCATTTGCAGAAAGGGGGCGG - Exonic
1185196125 22:49470591-49470613 CCCCAACTGCGGAAGGAGGACGG + Intronic
950481940 3:13249690-13249712 CCTCTTCTGAAAAACGAGGTGGG + Intergenic
950520820 3:13496788-13496810 CTTCCTCTGCACAAGGAAGTTGG - Exonic
953208087 3:40849657-40849679 TTTCATCTCCAGAAGGAGGGAGG + Intergenic
953227260 3:41032205-41032227 CCTCATCTGTAAAACGGGGTTGG - Intergenic
954646222 3:52133203-52133225 CCTCACATGCAGAAGGTGGAAGG - Intronic
954845177 3:53549495-53549517 CCTCAGCTGTAAAATGAGGTAGG + Intronic
955727383 3:61947860-61947882 CCTCCTCTGAAAAAGGAGGCAGG - Intronic
956072608 3:65470350-65470372 TATCCTCTGCAGAAAGAGGTAGG + Exonic
956499795 3:69869895-69869917 CCTCAGCTGGAGAAGGACATGGG - Intronic
961078367 3:124002995-124003017 CTCCCTCTGCTGAAGGAGGTGGG - Intergenic
961360634 3:126365066-126365088 CCTCCTCTGCAGGCAGAGGTGGG - Intergenic
961440087 3:126947603-126947625 CCCCGTCTGCAGAACGGGGTGGG + Intronic
961470310 3:127107239-127107261 CCTCATCGGCAGATGAAGCTGGG - Intergenic
962233790 3:133691181-133691203 CCTCTTCTCCACAATGAGGTTGG - Intergenic
964433727 3:156631177-156631199 CCACCTCTGCAGAAGTAGGGAGG - Intergenic
965603108 3:170473858-170473880 TCTCATCTGCAAAACGGGGTTGG + Intronic
966362731 3:179148154-179148176 CCTCTTCTGCCGGAGGAGGGGGG + Intronic
967641778 3:191874159-191874181 CCTCATCTACACCTGGAGGTTGG + Intergenic
968846120 4:3042439-3042461 CCTCAGCTGCAGAATGAAGATGG + Intergenic
969524327 4:7696494-7696516 CCTCATCTGTAACATGAGGTTGG + Intronic
969639248 4:8387253-8387275 CCTCATCTGCAGCACGGGGACGG - Intronic
969902590 4:10363439-10363461 CCCCATCAGCAGAAGATGGTTGG + Intergenic
970671647 4:18403607-18403629 CCTCATGGGCATAGGGAGGTTGG - Intergenic
972647070 4:40979059-40979081 TCTCATCTGCACAATGAGTTCGG + Intronic
974020217 4:56686636-56686658 ACTCATCTGTGGAAGGAGTTGGG + Intergenic
974084425 4:57244332-57244354 CCTCATCTACAGAAAGAGAAGGG - Intergenic
976218693 4:82738871-82738893 CCTCATCTGTAAAATGGGGTTGG - Intronic
976726919 4:88223794-88223816 CCTCATCTGGAGAGGGATGAAGG + Intronic
977574754 4:98663891-98663913 CATCCTCTGCAGAAAGAGGAAGG + Intergenic
979499170 4:121419048-121419070 TCTCATCTGCAAAAGTAAGTAGG + Intergenic
979812508 4:125055356-125055378 CCCCATCAGCAGAAGCAGCTAGG + Intergenic
980243106 4:130202315-130202337 GCTCATAGGCAGAAGGGGGTGGG + Intergenic
982874863 4:160634634-160634656 TCTCGACTGCAGAAGGAGGTGGG + Intergenic
984408803 4:179369541-179369563 CCTCAACTGCAAAAGGACGAGGG - Intergenic
984498133 4:180524504-180524526 CCTCAGCTTCTCAAGGAGGTGGG + Intergenic
984645008 4:182209882-182209904 AGTCATCTGCAGGGGGAGGTGGG + Intronic
984923042 4:184782719-184782741 CCTCCCCTGTAGAAGGAGCTAGG - Intronic
985477436 5:86190-86212 CAACATCTGGAGAAGGAAGTGGG - Intergenic
985791652 5:1931373-1931395 CCTCACCTGCAGAGGGAAGGCGG - Intergenic
985950680 5:3219508-3219530 CCTGATGAGCAGGAGGAGGTGGG + Intergenic
986972180 5:13349774-13349796 CCTCTTCTACAAGAGGAGGTGGG - Intergenic
987086612 5:14475403-14475425 TCTCTTCTGCAGAAGCAGATGGG + Intronic
987873663 5:23651632-23651654 CCTCAGCTGCAATATGAGGTTGG - Intergenic
990052781 5:51528890-51528912 CATCCTTTGCAGCAGGAGGTGGG + Intergenic
992712613 5:79475186-79475208 CCTCATCTTCAAAAGGGGGATGG - Intronic
992838671 5:80666169-80666191 CCTCATCTGCAGGCTAAGGTGGG - Intronic
993414844 5:87614287-87614309 CCTCCTTTGCAAAAGGATGTAGG + Intergenic
993721095 5:91322584-91322606 CCTCAGCTTCACAAGAAGGTGGG - Intergenic
995476714 5:112555441-112555463 CCTCATCTGCAAAGGAAGGAGGG + Intergenic
995755833 5:115503042-115503064 CCTCTTCTGCAGATGGATTTTGG - Intergenic
997398370 5:133582344-133582366 CCTCATCTGCAAAATGAGGTAGG + Intronic
997478172 5:134161076-134161098 CATCATCTTCAGGAGGAGGAGGG + Exonic
998157207 5:139793865-139793887 CCTCATCTGCCCAATGAGGATGG - Intergenic
998906461 5:146910548-146910570 CCTCATCTGCAAAAGGGTGATGG + Intronic
999095850 5:148977590-148977612 CCTCATCTGTAAAATGGGGTTGG - Intronic
999528751 5:152437976-152437998 CCTCCTCAGCAAAAGGAAGTTGG - Intergenic
1000028885 5:157384617-157384639 CACCATTTTCAGAAGGAGGTTGG - Intronic
1000597274 5:163230362-163230384 CCTCATCATCAGAAGAGGGTAGG - Intergenic
1001037387 5:168307164-168307186 CCTCATCTGCAGAATGGAGATGG - Intronic
1001058551 5:168468990-168469012 CGTCATCTGCAGAGAGAGCTGGG - Exonic
1001489376 5:172144852-172144874 CCTCATCTGTAAAAGGGGGTGGG - Intronic
1001492469 5:172165287-172165309 CCTCATCTGCAGAGTTGGGTTGG - Intronic
1001867317 5:175116839-175116861 CCTCATTTGAGGGAGGAGGTAGG + Intergenic
1001879992 5:175235017-175235039 CCTCGTCAGCAGAATGAGGTTGG - Intergenic
1001964775 5:175902515-175902537 TCTCATCTGCACCAGGAGGACGG + Intergenic
1002045614 5:176540248-176540270 CCTCATCTGTAAAATGAGGCTGG - Intergenic
1002151460 5:177235638-177235660 TCTCATATGCAAAAGGAGCTGGG - Intronic
1002252175 5:177936673-177936695 TCTCATCTGCACCAGGAGGACGG - Intergenic
1002810431 6:623021-623043 CCTCATCCTCAGAAGGAGCAGGG + Intronic
1003175283 6:3749551-3749573 CCTCACCTGGAGCAGGAGGGAGG - Intronic
1003333824 6:5152154-5152176 CCTCATCTATAGAATGAAGTTGG - Intronic
1003458864 6:6310659-6310681 TCTCATCTGCAAAATGAAGTTGG + Intronic
1004007152 6:11647517-11647539 CCTCATCTGTAAAACGAGGAGGG - Intergenic
1004955776 6:20726166-20726188 CCTCATCTGCAGAATAACCTTGG + Intronic
1005452940 6:25991921-25991943 CCACATCTGGAGAGGGAGGTGGG - Intergenic
1005497818 6:26404118-26404140 CAAGATCTGCAGAGGGAGGTGGG - Intronic
1005836642 6:29714438-29714460 CCTAATCTCCAGGAGGAGGTTGG + Intergenic
1006160679 6:32039077-32039099 GCTTGTCTGCAGGAGGAGGTGGG - Exonic
1006830734 6:36966690-36966712 CCTCATCTGAGAAAGGAGATTGG - Intergenic
1007452438 6:41950478-41950500 TCTCATTTGCAAAAGGAGGATGG + Intronic
1007615426 6:43176892-43176914 CCTCATCTGAATGAGGAGGTAGG - Intronic
1007940867 6:45780213-45780235 CCTCATCTGCAAAAGGAGAGGGG - Intergenic
1008062586 6:47014171-47014193 TCTGATCTGCAAAATGAGGTTGG + Intronic
1010977691 6:82334714-82334736 CCTCAGCTTCAGAAGTAGCTGGG + Intergenic
1012774045 6:103480252-103480274 CCTCATATGCAGAAGGGGAGAGG + Intergenic
1014796394 6:125729901-125729923 CCTCATTTACAAAAGGAAGTGGG - Intergenic
1015277747 6:131402273-131402295 GCTCATATGCATATGGAGGTGGG + Intergenic
1015621531 6:135137003-135137025 CCCCATCTGCAGAATGGGTTGGG + Intergenic
1017016032 6:150100192-150100214 ACTTATCAGCAGAAGAAGGTGGG + Intergenic
1018195744 6:161355083-161355105 CCTCAGCTGAAGCAGTAGGTAGG - Intronic
1018808736 6:167281809-167281831 CCACATCTGCAGGTGGAGCTTGG + Intronic
1019167874 6:170110854-170110876 TCTCACCTGCAGAAGGAGGCGGG + Intergenic
1019536680 7:1533124-1533146 CCTCATCTACAGCAGCTGGTCGG - Intronic
1019541928 7:1555479-1555501 ACTCATCTGCAGAGGGAGGGAGG + Exonic
1019609961 7:1931325-1931347 CCTCATCTGGAGAATGGGGAGGG + Intronic
1019993755 7:4710098-4710120 CCTCATCTGAATGAGAAGGTTGG + Intronic
1020035850 7:4962753-4962775 CCTCATCGGCAGGAGGGGATAGG - Intergenic
1020764605 7:12304096-12304118 CCTCTGCTGCAGGAGGAAGTGGG - Intergenic
1021314543 7:19130924-19130946 TCTCATGTGGAGAAGGAAGTAGG + Intergenic
1023339918 7:39209363-39209385 CATCATCTTCAGAAGTGGGTTGG + Intronic
1023574745 7:41615194-41615216 CATACTCTGCTGAAGGAGGTAGG - Intergenic
1024198983 7:47087786-47087808 CAACTTCTGTAGAAGGAGGTAGG + Intergenic
1025020779 7:55477520-55477542 CCTCACCTGCAGCAGGGGGTTGG - Intronic
1026095862 7:67346165-67346187 CGTCATGTGCCCAAGGAGGTCGG + Intergenic
1026854255 7:73742778-73742800 CCTCATCAGCAGAATAAGGACGG - Intergenic
1026935877 7:74254945-74254967 CCTCCTCTGCAAAATGGGGTGGG - Intergenic
1027414836 7:77963879-77963901 CCTCATCTGTAAAATGAGATAGG + Intergenic
1027872990 7:83732933-83732955 CATAATCTACAGAAGGAGGTAGG + Intergenic
1028301139 7:89202657-89202679 CCTCATCTGGAAAATGAGGTTGG - Intronic
1028983239 7:96989847-96989869 CCTCAACTGGAAAAGGAGTTGGG + Intergenic
1029259783 7:99294006-99294028 CCTCATTTGCAGGAGGAAGCTGG + Intergenic
1029284953 7:99459049-99459071 CCTCAGCCTCAGAAGAAGGTGGG + Intronic
1029682477 7:102121281-102121303 CCTCAGCTGCTGGAGGAGCTGGG + Intronic
1030531696 7:110718783-110718805 CCTCAGATGCAGATAGAGGTTGG + Intronic
1031966307 7:128030735-128030757 TTCCATCTGGAGAAGGAGGTGGG + Exonic
1033348678 7:140544644-140544666 CCTCCTCTCCAGAAGCAGGGAGG + Exonic
1033444618 7:141409452-141409474 CCTCATCTGTATAATGAGGATGG + Intronic
1033579785 7:142721763-142721785 ACTCTGCTGCAGAAGGTGGTAGG + Intergenic
1033724866 7:144104158-144104180 CCCCATCTGCAAAATGGGGTGGG - Intergenic
1034343052 7:150370112-150370134 CCTCCTCCGCGGAAGGAGGAAGG - Intronic
1034401170 7:150862587-150862609 CCTCAGCTCCAGAGGGAGGGAGG - Intergenic
1034544802 7:151782717-151782739 CCTCATCTGTAAAATGAGGATGG + Intronic
1035210817 7:157326801-157326823 CCTCAGCTTCCCAAGGAGGTGGG + Intergenic
1036470483 8:9048441-9048463 CCAGAGCTGCAGAAGGAGTTTGG - Intronic
1036558728 8:9883854-9883876 CCTAATCAGCAGCAGGAGGCAGG + Intergenic
1037177651 8:15966046-15966068 CATCTTCTGCACAAGGAGGCAGG + Intergenic
1038281341 8:26168045-26168067 CCTCAGAAGGAGAAGGAGGTGGG - Intergenic
1038352214 8:26787032-26787054 CCTCATCTGTAAGATGAGGTTGG - Intronic
1038382420 8:27108838-27108860 CCTCATTTGCAGGAGCAGGCAGG + Intergenic
1039473534 8:37827694-37827716 CCTCATCTGAAGGAGGAGGCTGG + Intronic
1039517250 8:38144381-38144403 CCACCCCTGCAGTAGGAGGTAGG + Exonic
1040566930 8:48575925-48575947 CCTCATCTGCAAAACAAGGTGGG - Intergenic
1041748761 8:61236766-61236788 CCTCATTTGTAAAATGAGGTCGG - Intronic
1042383845 8:68150612-68150634 CCTAATCATCAGAAGCAGGTAGG - Intronic
1042401505 8:68353953-68353975 CCTCAGATGCAGAAGGGGATTGG - Intronic
1042892153 8:73624552-73624574 CCTCATCTGTAAAATGAAGTGGG - Intronic
1044391759 8:91660669-91660691 CCTCATCTGCAGACTGAGCCAGG + Intergenic
1045321135 8:101081985-101082007 CCTCTCCTGCAGAAGTGGGTAGG - Intergenic
1045860500 8:106811032-106811054 CCTCACCTGGAGAGGGAGGTTGG - Intergenic
1045864114 8:106845335-106845357 ACTCATTTTCAGAAGGAGGCAGG - Intergenic
1046272580 8:111915867-111915889 CCTGATTAGCAGGAGGAGGTGGG + Intergenic
1047010107 8:120663197-120663219 CCTCATCTGCAGATAGAAATGGG + Intronic
1047555182 8:125921484-125921506 CTTCATCTGCAAAATGAGGTTGG + Intergenic
1049223764 8:141440048-141440070 CCTCATCTGTAGAATGGGGCAGG - Intergenic
1049310324 8:141930761-141930783 CCTCATCTGTAGATGCAGGGTGG - Intergenic
1049378286 8:142299439-142299461 CCTCATCTGCAGAAGGCGCTAGG - Intronic
1050063931 9:1738850-1738872 CCTAATTTGGAGAAGGAGGAGGG - Intergenic
1050958350 9:11693835-11693857 CCTCAGCCTCAGAAGTAGGTGGG + Intergenic
1053454808 9:38225873-38225895 CCTCATCTGTAAAAGGTGGGGGG + Intergenic
1053710310 9:40800474-40800496 CCTGATTAGCAGGAGGAGGTAGG + Intergenic
1054420217 9:64921269-64921291 CCTGATTAGCAGGAGGAGGTAGG + Intergenic
1055027269 9:71735665-71735687 CCTCAGCTGCCCAAGGAGCTGGG - Intronic
1056399824 9:86215722-86215744 CCTCAGCTGCCCAAGTAGGTGGG - Intergenic
1056756490 9:89385174-89385196 CCTCAAAGGCAGAAGGGGGTAGG - Intronic
1057042257 9:91856238-91856260 CCTCAGCTGCACAAGTAGCTGGG - Intronic
1057355083 9:94325693-94325715 CCTCATCTGGACAAAGACGTTGG + Exonic
1057652668 9:96931941-96931963 CCTCATCTGGACAAAGACGTTGG - Exonic
1058120634 9:101134969-101134991 CCTCATCTGCAAAATGGGGAAGG - Intronic
1058656528 9:107226980-107227002 ACTTATGTGCAGAAGGAGGATGG + Intergenic
1058669356 9:107347591-107347613 CATCTTCTACAGAAGGAAGTGGG - Intergenic
1058995180 9:110292381-110292403 CCTCCTTTGCAGGACGAGGTGGG - Intergenic
1059812882 9:117876064-117876086 CCTCATCTTCAAAAAGAAGTGGG - Intergenic
1059930604 9:119256693-119256715 CCTCATCTGTAAAATGGGGTGGG + Intronic
1060000968 9:119958372-119958394 CCACATCTGCAGAGTGAGGATGG - Intergenic
1060173325 9:121479279-121479301 TCCCTTCTGCAGAAGGAGGCAGG + Intergenic
1060218602 9:121752881-121752903 CCTCATCTGAAAAAGGAGGAAGG - Intronic
1061049335 9:128185404-128185426 CCTCATCTGTAAAATGAGGGGGG - Intronic
1061262779 9:129489127-129489149 CATCATCTGCAGTAGGACGGGGG + Intergenic
1061866618 9:133494678-133494700 CCTTATCTGCAGGAGGAGGCGGG - Intergenic
1062197586 9:135282823-135282845 CCTCCTTGGCAGAAGGAGGTTGG + Intergenic
1062215905 9:135389771-135389793 GCTCATATGAAGAAGGAGGGGGG + Intergenic
1185944496 X:4359663-4359685 ACTCATCTGTTGAAGGACGTTGG - Intergenic
1186428987 X:9488396-9488418 GCTCCTCTGCAGATGGAGGAAGG - Intronic
1186438852 X:9567498-9567520 CCTCATCTGCTGAACCATGTGGG - Intronic
1186555859 X:10557582-10557604 CCTCATCTGCAGAATGAGGATGG + Intronic
1186815914 X:13238017-13238039 CTTCACATGCAGATGGAGGTGGG - Intergenic
1187297046 X:18012127-18012149 CCTGATCAGCAGGAGGAGGTAGG + Intergenic
1187650782 X:21403192-21403214 TCACATCTGCAAAATGAGGTGGG - Intronic
1188577096 X:31664611-31664633 CCTCAACTGGAGCAGGAGGCAGG + Intronic
1189359811 X:40341220-40341242 CATGATCTTCAGGAGGAGGTAGG - Intergenic
1190115647 X:47624789-47624811 CCTCATCTGCAAAATGAGAATGG + Intronic
1190261214 X:48798511-48798533 CCTCCTCTGCAGATAGATGTGGG + Intergenic
1194316020 X:92379108-92379130 CCTCCAATTCAGAAGGAGGTGGG - Intronic
1195203025 X:102567553-102567575 CCTCATTTGCAAAATGGGGTTGG + Intergenic
1197873664 X:131083071-131083093 CCTGATCTGCAGCAGGGGGAGGG - Intronic
1198399681 X:136256802-136256824 CCTCATCTGTAAAATGAGGATGG - Intergenic
1198575843 X:138009484-138009506 CCTCATCTGAAAAATGTGGTGGG + Intergenic
1199513063 X:148644429-148644451 CCTCATCCGCAAAATGAGGATGG + Intronic
1199709576 X:150459606-150459628 CCTCATCTGTACAATGAGGGTGG + Intronic
1199722850 X:150555015-150555037 CCTCATCTGCAAAAGAGGGATGG + Intergenic
1199927780 X:152486849-152486871 CCAGATCTGCAAAAGGTGGTTGG - Intergenic