ID: 905833931

View in Genome Browser
Species Human (GRCh38)
Location 1:41100232-41100254
Sequence TCTCTTTTATCACCATACCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 183}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905833931_905833934 7 Left 905833931 1:41100232-41100254 CCCGGGTATGGTGATAAAAGAGA 0: 1
1: 0
2: 0
3: 15
4: 183
Right 905833934 1:41100262-41100284 AAGCACTTTCCACTTAGCCTGGG 0: 1
1: 0
2: 1
3: 14
4: 132
905833931_905833933 6 Left 905833931 1:41100232-41100254 CCCGGGTATGGTGATAAAAGAGA 0: 1
1: 0
2: 0
3: 15
4: 183
Right 905833933 1:41100261-41100283 AAAGCACTTTCCACTTAGCCTGG 0: 1
1: 0
2: 0
3: 20
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905833931 Original CRISPR TCTCTTTTATCACCATACCC GGG (reversed) Intronic
900674624 1:3877062-3877084 TTTCTTTTAACACCATAGCGGGG + Intronic
905138707 1:35822920-35822942 TTTCTTTTGCCATCATACCCAGG - Exonic
905523223 1:38616060-38616082 TCTCTTCTACCACAATCCCCAGG - Intergenic
905833931 1:41100232-41100254 TCTCTTTTATCACCATACCCGGG - Intronic
906480514 1:46196448-46196470 TTTATTTTATAACCATCCCCTGG - Intronic
908337606 1:63143572-63143594 TTTCCTTTATCACCCTACCAGGG + Intergenic
908729272 1:67208976-67208998 CCTCTTTTATCAGCATAACCTGG + Intronic
909808621 1:79904338-79904360 TCTCTTAGATAACTATACCCAGG - Intergenic
911275056 1:95850234-95850256 CCTCTTGTATCAGCATAACCCGG + Intergenic
911982384 1:104583311-104583333 CCTCTTGTATCACCTTGCCCTGG - Intergenic
913186756 1:116375431-116375453 TCTCCTTTATAACCACACACAGG + Intronic
913426726 1:118739458-118739480 ACGCTTTTATCACTAAACCCAGG - Intergenic
917638614 1:176960685-176960707 CTTCTTTTTTCACCAAACCCTGG + Intronic
918542853 1:185650186-185650208 TCTGATTTACCACCATAACCTGG - Intergenic
921610465 1:217206957-217206979 CCTCTTGCATCACCATAACCTGG + Intergenic
923805783 1:237256409-237256431 TTTCTATAATCACCATACACAGG - Intronic
1064804992 10:19120616-19120638 TCTCTCTTCTCCCCCTACCCTGG - Intronic
1066041058 10:31548359-31548381 CCTCTTTCATCAGCGTACCCTGG + Intergenic
1067205882 10:44212999-44213021 TCTGTTTTGTCACCATTCCTTGG - Intergenic
1079583524 11:22096197-22096219 TCTCTTAATTCTCCATACCCAGG - Intergenic
1079657781 11:23003605-23003627 TCTCTTTCATCAGCATGACCTGG - Intergenic
1080154586 11:29094165-29094187 TCTCTTCTACCATCATATCCTGG - Intergenic
1080672862 11:34396983-34397005 TCTCCTTTCTAACCATACCCAGG + Intergenic
1081614222 11:44580990-44581012 TCTCTCTAATCACCCTACTCAGG + Intronic
1081886230 11:46499122-46499144 TCTCTTGTATTACCATTCCTTGG - Intronic
1082748445 11:56993682-56993704 TCTCTTGCATCACCATGACCTGG - Intergenic
1082926811 11:58557054-58557076 GTTCTTTTTTCTCCATACCCTGG - Intronic
1085283720 11:75346713-75346735 TCCCTCTTCTCTCCATACCCAGG + Intronic
1087953057 11:104249043-104249065 TATCTTTTAATACCATATCCCGG + Intergenic
1088587107 11:111369004-111369026 TCTCTGTCTTCAGCATACCCAGG + Intronic
1088812588 11:113401577-113401599 TCACTTTTGTGACCACACCCAGG + Intergenic
1089673187 11:120071382-120071404 TTTCTTTAATCACTATTCCCTGG - Intergenic
1089857181 11:121556434-121556456 TCACTTCTATCAGCATCCCCAGG - Intronic
1090595298 11:128314768-128314790 CCTCTTGCATCAGCATACCCTGG - Intergenic
1090766537 11:129880924-129880946 TCTCTCTTTTCACCATCACCAGG + Intronic
1093045842 12:14443309-14443331 TCTCATCTTTCTCCATACCCTGG - Intronic
1093181964 12:15976906-15976928 TCTACTGTAGCACCATACCCTGG + Intronic
1095069812 12:37827257-37827279 TTTCCTTTTTCACCATAGCCAGG - Intergenic
1095482789 12:42652984-42653006 TTTTTTTAATCACCAGACCCTGG - Intergenic
1096114007 12:49044522-49044544 TCTCTTCTGTCACCATACGCAGG - Exonic
1096236988 12:49935909-49935931 TCTCTTTTTTCCCATTACCCTGG + Intergenic
1097091846 12:56511908-56511930 TTTCTATTGTCACCAAACCCTGG - Intergenic
1103178391 12:118885531-118885553 TTTCTTTTTTTACCATACTCAGG - Intergenic
1104209359 12:126672566-126672588 TCTCTTTTATAGATATACCCAGG + Intergenic
1106657335 13:31759999-31760021 TCTCTGTTATCACAGCACCCTGG + Intronic
1107126166 13:36849313-36849335 TCCCTTTTATCACCATTCAAAGG + Intronic
1111182088 13:84682835-84682857 TTTTTGTTATCACCATACACTGG - Intergenic
1112124725 13:96452742-96452764 TGTTTTTTATTTCCATACCCTGG + Intronic
1112407467 13:99134029-99134051 TCCCATTTATCACCATGGCCCGG - Intergenic
1112755136 13:102624276-102624298 TCTCCTTTTTCCCCCTACCCTGG - Intronic
1116212975 14:41972012-41972034 TGTCTTGAATCACCATGCCCTGG - Intergenic
1116309932 14:43312021-43312043 TCTCTTATATACCCATTCCCTGG + Intergenic
1119868322 14:77992529-77992551 TCTCTTTCATCATTATTCCCAGG - Intergenic
1121914200 14:97821022-97821044 TCCCTTGCATCAGCATACCCTGG + Intergenic
1128263683 15:66250963-66250985 TCTCCTTTCTCATCATTCCCAGG - Intronic
1130128359 15:81114106-81114128 TCTATTTTTTCTCCATGCCCAGG - Intronic
1131330970 15:91498967-91498989 TCTCTTTCTTCCCCATCCCCAGG - Intergenic
1131352549 15:91714608-91714630 TCTCTTCTATCACCTTAGGCAGG - Intergenic
1131573824 15:93566562-93566584 TCTCCTTTAATCCCATACCCAGG - Intergenic
1137021560 16:35432966-35432988 ACTCTTTTAGCCACATACCCAGG - Intergenic
1137993767 16:53186235-53186257 CCTCTTGTATCAGCATGCCCTGG + Intronic
1139945933 16:70642089-70642111 TCTGTTTTCTCACCATTCTCTGG + Intronic
1140587360 16:76309259-76309281 CATCATTTATCTCCATACCCTGG - Intronic
1145021011 17:19430900-19430922 ACACTTTTACCACCATAGCCTGG - Intergenic
1148147216 17:45373533-45373555 TCTCCTCTAACACCATACCCAGG - Intergenic
1149131250 17:53304854-53304876 CCTCTTTTATCAGCATGACCTGG - Intergenic
1149211127 17:54302613-54302635 TTTCTTTTATGACCTTACCCAGG + Intergenic
1151208269 17:72524541-72524563 TCTCTTTTCTCCCCAGCCCCTGG - Intergenic
1151781958 17:76252687-76252709 TTTTTTTTTTCACTATACCCGGG + Intergenic
1154686722 18:17551173-17551195 TCTCTTTTTTCACCTTAGGCCGG - Intergenic
1158199593 18:54925008-54925030 TTCTTTTTATGACCATACCCTGG + Intronic
1160295718 18:77634863-77634885 TCTTTCTTATCACAAAACCCAGG + Intergenic
1163531784 19:17854186-17854208 TCTCTGTTATCACCATCCAGTGG - Intergenic
1166705615 19:44906396-44906418 TCTCTTATCTCCCCATCCCCAGG - Intronic
926483900 2:13432063-13432085 TCTCTTTCATCAGCATGCCCTGG - Intergenic
926641467 2:15242512-15242534 TATATTTTTTAACCATACCCTGG - Intronic
928304057 2:30151373-30151395 TCTCTTTTATCAGAAGACTCTGG - Intronic
928785156 2:34875255-34875277 TCTCTTTTCTCATGCTACCCTGG - Intergenic
930506826 2:52293090-52293112 TCTGCTTTATCATCCTACCCTGG + Intergenic
930514812 2:52393443-52393465 TTTCTTTCATCAGCATGCCCTGG - Intergenic
932821565 2:74906084-74906106 TCTCTTGCATCACCATAACCTGG - Intergenic
933275480 2:80279264-80279286 TCTATTATATCACCAGAGCCTGG - Intronic
933799534 2:85949650-85949672 TCTCTTTTTTCACCATGCACTGG - Intergenic
934574733 2:95392704-95392726 GCTATTTTATCCCCATTCCCTGG - Intergenic
938245956 2:129778228-129778250 TCCCTTGTATCACCGTCCCCCGG - Intergenic
940617670 2:156070372-156070394 TCCCTTTTACCTCCCTACCCAGG - Intergenic
941303095 2:163828514-163828536 TCTCTTGCATCAGCATAACCTGG - Intergenic
941977803 2:171424500-171424522 CCTCTTGTATCAGCATGCCCTGG + Intronic
943343454 2:186709167-186709189 TCTCATGTAGCACCATGCCCTGG - Intronic
944241527 2:197490237-197490259 TTTCTATTGTCACCAAACCCTGG + Exonic
945728589 2:213504327-213504349 TTTGTTTTATTACCATAACCAGG - Intronic
945931064 2:215855060-215855082 CCTCTTTTATCAGCATGACCTGG + Intergenic
946142349 2:217702505-217702527 TCACTTTTCTCACCCTAACCTGG - Intronic
948600136 2:239103218-239103240 TCTATTTTAAGACCAGACCCTGG - Intronic
1170534792 20:17329865-17329887 CCTCTTTCATCTCCACACCCCGG + Intronic
1171640483 20:27343713-27343735 TTTCCTTTTTCACCATACGCCGG - Intergenic
1172388671 20:34551372-34551394 TCTCATTTCTCACCATATTCTGG - Intronic
1173308986 20:41879353-41879375 TCTCTTTATTCACCACATCCAGG + Intergenic
1175765069 20:61586779-61586801 TCTCTTGTCTCTCCATAACCTGG - Intronic
1178064393 21:28888067-28888089 TTTCTATTGTCACCAAACCCTGG + Intergenic
1183184905 22:36286183-36286205 TCTTACTTATCGCCATACCCTGG - Intronic
950589379 3:13925213-13925235 TCTCTTACATCAGCATGCCCTGG + Intergenic
951735983 3:25864847-25864869 TCTTTTTAATGACAATACCCAGG - Intronic
952401277 3:32966284-32966306 TCTCTTGCATCACCATGACCTGG + Intergenic
953614550 3:44478088-44478110 TCCCCATCATCACCATACCCAGG + Intergenic
953624768 3:44561789-44561811 TCTCTTGCATCAGCATGCCCTGG - Intronic
957622836 3:82617408-82617430 TCTATTTTATAACAAGACCCAGG + Intergenic
957630452 3:82710874-82710896 TCTCTTACATCAGCATAACCTGG - Intergenic
958059197 3:88457009-88457031 TTTTTTTTATAAACATACCCTGG - Intergenic
959161085 3:102725035-102725057 CCTCTTGTATCAGCATAACCTGG + Intergenic
963078251 3:141368037-141368059 GCACTTTTGTCACCATCCCCGGG - Intronic
968986187 4:3875774-3875796 TGCCTTTTCTCACCATACTCTGG - Intergenic
969218490 4:5743195-5743217 TCACTTTCATCACCATCCACTGG + Intronic
970513638 4:16805563-16805585 TCTCATCTCTCTCCATACCCTGG - Intronic
974248944 4:59360207-59360229 CCTCTTGTATCACCATGCCCTGG + Intergenic
974569699 4:63628509-63628531 CCTCTTTTATCAGCATGACCTGG + Intergenic
977749027 4:100586373-100586395 TCTGTTTTATCAAGATATCCTGG + Intronic
978832215 4:113101963-113101985 TCTCTATCCTCACCATACACCGG - Intronic
978972245 4:114822732-114822754 TCTCATATATCACCAAAGCCTGG - Intergenic
981446606 4:144846533-144846555 TTTCTATTGTCACCAAACCCTGG - Intergenic
983274369 4:165599797-165599819 TCTCTTTTCTCACCAGTTCCTGG + Intergenic
984922504 4:184778172-184778194 ACTCTTTCACTACCATACCCAGG + Intronic
984948226 4:184986607-184986629 TCTCTGTTGTCCCCATCCCCAGG + Intergenic
985618191 5:937192-937214 CCTCTTTTATCACCCCTCCCCGG - Intergenic
986577516 5:9227997-9228019 TCACTGCTATGACCATACCCAGG - Intronic
986965971 5:13271665-13271687 TTTGTTTTCTGACCATACCCTGG - Intergenic
987388581 5:17353896-17353918 TCTCTTTGACCAGCACACCCTGG - Intergenic
987739177 5:21883497-21883519 TTTCTATTGTCACCAAACCCTGG - Intronic
988300320 5:29416734-29416756 TCTCCTTTACCCCCAGACCCTGG - Intergenic
990022429 5:51144209-51144231 TCTATTTTATCACCTTAGCCTGG + Intergenic
992179181 5:74180171-74180193 TTTCTTTTATCAATTTACCCTGG - Intergenic
993413138 5:87596263-87596285 CCTCTTGCATCAGCATACCCTGG - Intergenic
994028077 5:95108127-95108149 TCTCCTTTATCTCCATACACTGG + Intronic
995200096 5:109415484-109415506 TCTCTTGTATCAGCATGACCTGG + Intergenic
996012068 5:118492208-118492230 TCTCTGTTTTCAGCATATCCTGG - Intergenic
996120240 5:119663677-119663699 TCTATTTATTCACCATTCCCTGG + Intergenic
997804497 5:136902951-136902973 TCTCATTTATCACTATTCCTAGG + Intergenic
999715528 5:154357044-154357066 CCTCTTCTATAAACATACCCGGG - Intronic
1000352530 5:160363100-160363122 TCCCTTTTAACACCAAACACAGG - Intronic
1001268228 5:170290684-170290706 TGTCTTCTTTCACCATCCCCTGG + Intronic
1002539835 5:179899148-179899170 TCTCTGTTCTCACCCTTCCCTGG - Intronic
1002833008 6:841270-841292 TCTCTCTGAGCACCATACCGTGG + Intergenic
1002875288 6:1204514-1204536 CCTCATTTTTCACCATCCCCGGG - Intergenic
1003976061 6:11345858-11345880 TATCTTGTACCACCATTCCCTGG + Intronic
1008422454 6:51317741-51317763 TCTCTTTTATAGTCATAACCTGG + Intergenic
1009529060 6:64786590-64786612 TCTCTCTTGACACCATACCGGGG + Intronic
1011738197 6:90333592-90333614 TCTCTTGCATCAGCATGCCCTGG - Intergenic
1014219981 6:118790147-118790169 TCTCCTTTCTCTCTATACCCAGG - Intergenic
1015308897 6:131743058-131743080 TCTCTTTTATAATCATAGCTTGG - Intronic
1016662897 6:146601669-146601691 TTTCTTTTATTTCCATATCCAGG - Intronic
1016682276 6:146844908-146844930 TCTCTTGCATCAGCATACCCTGG - Intergenic
1017248561 6:152254995-152255017 TCTCGATTATCACCATTCTCTGG + Exonic
1017540993 6:155403023-155403045 TCTCTTTAATAACCATCCCGAGG + Intronic
1018350305 6:162951494-162951516 TCTGTTTTATCACCAAACATAGG + Intronic
1018358316 6:163040617-163040639 CCTCTTTCATCAGCATGCCCTGG + Intronic
1018489766 6:164279917-164279939 CCTCTTGTATCAGCATGCCCTGG + Intergenic
1018831201 6:167444943-167444965 TCTCTTCTATGAGCAGACCCAGG + Intergenic
1020020335 7:4862598-4862620 TCTCTTTAATAATCTTACCCAGG + Intronic
1020392794 7:7676347-7676369 ACTATTATATCACCATACACAGG + Intronic
1021575502 7:22102326-22102348 TCTATTTTATCATCATCCCTTGG + Intergenic
1021644160 7:22771436-22771458 TCCCTTTTCTCCCCATCCCCTGG - Intergenic
1027861828 7:83593755-83593777 TCTCTTTTATCTCTAGACCCGGG - Intronic
1027977645 7:85179394-85179416 CCTCTTGTATCAGCATAACCTGG + Intronic
1036283300 8:7419752-7419774 TTTCTATTGTCACCAAACCCTGG - Intergenic
1036338170 8:7891769-7891791 TTTCTATTGTCACCAAACCCTGG + Intergenic
1037653560 8:20863119-20863141 TCTCTTTTTATATCATACCCAGG + Intergenic
1039333008 8:36559732-36559754 TCTCATTTTTCACCAAACTCCGG - Intergenic
1039566415 8:38555213-38555235 TCTGTTTTATCTCCATCTCCAGG + Intergenic
1043518623 8:81019967-81019989 CCTCTTATATCAGCATGCCCTGG + Intronic
1044368483 8:91378689-91378711 TCTCTCTCATGACCATACACTGG + Intronic
1044422489 8:92013856-92013878 TCTCTTTTATCCCCAGCTCCTGG - Intronic
1046559807 8:115821431-115821453 TCTATTTTCTCACTATTCCCTGG + Intergenic
1047493034 8:125389956-125389978 TTTTTTTTACCACCATATCCTGG - Intergenic
1047922069 8:129645526-129645548 TGTCTTTTGACACCATACCAGGG + Intergenic
1048944819 8:139434874-139434896 TCTCTTTTTTCAAAATACCTGGG - Intergenic
1049162181 8:141104695-141104717 TGTCTTTCATCCCCATCCCCAGG - Intergenic
1053007599 9:34614399-34614421 GCTCTTTTTTCACTATTCCCAGG - Intronic
1055035576 9:71814898-71814920 TCTCTTTCACCTCCCTACCCTGG + Intronic
1057153319 9:92814986-92815008 TCCCTGTTATAACCACACCCAGG + Intergenic
1058593483 9:106589683-106589705 TCTCTTTCTTCAGAATACCCTGG - Intergenic
1059581676 9:115556075-115556097 GCTCTTTCATCAGCATACCCTGG - Intergenic
1061156178 9:128863164-128863186 TCTGTTCTATTACCACACCCAGG + Intronic
1186792991 X:13017067-13017089 TTTCTTTTATCACCATTGCCAGG + Intergenic
1186962518 X:14751877-14751899 TCACTTTTTTCACAGTACCCTGG + Intergenic
1189527793 X:41843691-41843713 TCTCATCTTTCTCCATACCCTGG + Intronic
1191095134 X:56665616-56665638 TCTCTTGCATCAACATATCCTGG + Intergenic
1194365197 X:93006164-93006186 CCTCTTGCATCACCATGCCCTGG - Intergenic
1194624506 X:96212978-96213000 TCTCTTGTATCAGCATGACCTGG - Intergenic
1197331291 X:125156205-125156227 TCTCTTTTGTAACCATCCGCAGG + Intergenic
1197441345 X:126494737-126494759 TCTCTTGCATCAGCATGCCCTGG + Intergenic
1198147892 X:133876400-133876422 TCTTTAGTATCACCTTACCCTGG - Intronic
1198612577 X:138418289-138418311 TCTCTTGCATCAGCATGCCCTGG + Intergenic
1198660879 X:138966392-138966414 CCTCTTGTATCAGCATAACCTGG + Intronic
1198736190 X:139787688-139787710 TCTCTGTTATCAACTTATCCAGG - Intronic
1199806428 X:151305273-151305295 CCTCTTGCATCAACATACCCTGG - Intergenic
1202261268 Y:22972875-22972897 TCTCTTTTATAACCAAAGACGGG + Intergenic
1202414256 Y:24606616-24606638 TCTCTTTTATAACCAAAGACGGG + Intergenic
1202456529 Y:25063470-25063492 TCTCTTTTATAACCAAAGACGGG - Intergenic
1202585115 Y:26415432-26415454 TCTCTTTTCTACCCCTACCCAGG + Intergenic