ID: 905834410 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:41105069-41105091 |
Sequence | CTTCAATATCCGAAGTAGCT GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 19440 | |||
Summary | {0: 1, 1: 0, 2: 35, 3: 1053, 4: 18351} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
905834405_905834410 | 9 | Left | 905834405 | 1:41105037-41105059 | CCTCTGCCTCCTGGGTTCAAGTG | 0: 9186 1: 33764 2: 74834 3: 112568 4: 133392 |
||
Right | 905834410 | 1:41105069-41105091 | CTTCAATATCCGAAGTAGCTGGG | 0: 1 1: 0 2: 35 3: 1053 4: 18351 |
||||
905834406_905834410 | 3 | Left | 905834406 | 1:41105043-41105065 | CCTCCTGGGTTCAAGTGATTCTC | 0: 21628 1: 64917 2: 122797 3: 157734 4: 166761 |
||
Right | 905834410 | 1:41105069-41105091 | CTTCAATATCCGAAGTAGCTGGG | 0: 1 1: 0 2: 35 3: 1053 4: 18351 |
||||
905834407_905834410 | 0 | Left | 905834407 | 1:41105046-41105068 | CCTGGGTTCAAGTGATTCTCCTG | 0: 34141 1: 101530 2: 153868 3: 199323 4: 172421 |
||
Right | 905834410 | 1:41105069-41105091 | CTTCAATATCCGAAGTAGCTGGG | 0: 1 1: 0 2: 35 3: 1053 4: 18351 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
905834410 | Original CRISPR | CTTCAATATCCGAAGTAGCT GGG | Intronic | ||
Too many off-targets to display for this crispr |