ID: 905834410

View in Genome Browser
Species Human (GRCh38)
Location 1:41105069-41105091
Sequence CTTCAATATCCGAAGTAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 19440
Summary {0: 1, 1: 0, 2: 35, 3: 1053, 4: 18351}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905834405_905834410 9 Left 905834405 1:41105037-41105059 CCTCTGCCTCCTGGGTTCAAGTG 0: 9186
1: 33764
2: 74834
3: 112568
4: 133392
Right 905834410 1:41105069-41105091 CTTCAATATCCGAAGTAGCTGGG 0: 1
1: 0
2: 35
3: 1053
4: 18351
905834406_905834410 3 Left 905834406 1:41105043-41105065 CCTCCTGGGTTCAAGTGATTCTC 0: 21628
1: 64917
2: 122797
3: 157734
4: 166761
Right 905834410 1:41105069-41105091 CTTCAATATCCGAAGTAGCTGGG 0: 1
1: 0
2: 35
3: 1053
4: 18351
905834407_905834410 0 Left 905834407 1:41105046-41105068 CCTGGGTTCAAGTGATTCTCCTG 0: 34141
1: 101530
2: 153868
3: 199323
4: 172421
Right 905834410 1:41105069-41105091 CTTCAATATCCGAAGTAGCTGGG 0: 1
1: 0
2: 35
3: 1053
4: 18351

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905834410 Original CRISPR CTTCAATATCCGAAGTAGCT GGG Intronic
Too many off-targets to display for this crispr