ID: 905840981

View in Genome Browser
Species Human (GRCh38)
Location 1:41177831-41177853
Sequence GAGAACTTCCCCAATTAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 3, 2: 13, 3: 36, 4: 109}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905840977_905840981 12 Left 905840977 1:41177796-41177818 CCAAGTTGGAAAACACTCTTCAG 0: 1150
1: 6012
2: 2280
3: 776
4: 518
Right 905840981 1:41177831-41177853 GAGAACTTCCCCAATTAGCAAGG 0: 1
1: 3
2: 13
3: 36
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905840981 Original CRISPR GAGAACTTCCCCAATTAGCA AGG Intronic
902821753 1:18947678-18947700 GAGACCTTCTCCAAAGAGCAGGG + Intronic
904589791 1:31606260-31606282 AAGAACTATCCCAATTAGCCAGG + Intergenic
904615815 1:31749048-31749070 GACACCTTCCCTAATTTGCATGG + Intronic
905840981 1:41177831-41177853 GAGAACTTCCCCAATTAGCAAGG + Intronic
906396870 1:45473956-45473978 TAAAACTTCCCCAATTGGCTGGG - Intronic
906584391 1:46963793-46963815 GAGAACTTCCCAATCTAGCAAGG - Intergenic
919456865 1:197830712-197830734 GAGAACTCCCCAACCTAGCAAGG + Intergenic
921979076 1:221235518-221235540 CAAAACATTCCCAATTAGCATGG - Intergenic
922383717 1:225060075-225060097 GAGAACTTCCCAATCTAGCAAGG - Intronic
922387872 1:225106430-225106452 GAGAACTTCCCAATCTAGCAAGG - Intronic
923863778 1:237917917-237917939 AAAAACTTTCCCAAGTAGCAGGG - Intergenic
924665429 1:246066667-246066689 GAAAACTTAAGCAATTAGCAAGG - Intronic
1063434311 10:6018201-6018223 GAGGACATCCCCAAAGAGCAAGG + Intronic
1065098125 10:22302879-22302901 GAGAGATTCCTGAATTAGCAAGG - Intergenic
1066639348 10:37539529-37539551 GAGAACTTCCCTATCTAGCAAGG + Intergenic
1066813456 10:39371665-39371687 GAGAACTTCCCTATCTAGCAAGG - Intergenic
1069633949 10:69914066-69914088 GAGGACAACCCCAATTAGCCTGG + Intronic
1070603297 10:77880619-77880641 CTGAACTTCCCCAGTTATCAAGG + Intronic
1072370036 10:94756976-94756998 GAGAATTTCCCAACCTAGCAAGG - Intronic
1072401725 10:95109816-95109838 GAGAACTTCCCAATCTAGCAAGG - Intergenic
1074222467 10:111451640-111451662 GATAACTTCCCCAAGCAGCAAGG + Intergenic
1078688874 11:13559509-13559531 GAGAACTTCCCAGTCTAGCAAGG - Intergenic
1086440914 11:86829043-86829065 GACAACTTCCCAATATAGCAAGG - Intronic
1087925305 11:103912072-103912094 GAGAATTTCCCCATCTATCAGGG + Intronic
1089101796 11:115968517-115968539 GAGAACTTCCCAATCTAGCAAGG + Intergenic
1089106104 11:116006493-116006515 GAGAACTTCCCAATCTAGCAAGG + Intergenic
1089596411 11:119583753-119583775 GAGAACATCCCCACTCAGCCAGG - Intergenic
1091958924 12:4673761-4673783 GAGAACTTCCCCAACTAGCAAGG + Intronic
1093649422 12:21626112-21626134 GAGAACTTCCCAACATAGCAAGG - Intergenic
1095228082 12:39700528-39700550 CAGAACTTCCCAATCTAGCAAGG + Intronic
1095373439 12:41497626-41497648 AAGAACTCCCACAATTAGCCAGG + Intronic
1099106921 12:78508014-78508036 GAGAACTTCCCCATCTAGCAAGG + Intergenic
1099370361 12:81821826-81821848 GAAAACTTCCCCGATCACCAGGG + Intergenic
1101438327 12:104683148-104683170 GAGAATGTCACCAATGAGCAGGG + Intronic
1102962266 12:117100333-117100355 CAGAACTTCCCTAATGGGCATGG - Intergenic
1103183699 12:118937428-118937450 GAGAACTTCCCTAATTCCTATGG + Intergenic
1107838034 13:44427956-44427978 GAGAGCTTCCCCTATTGCCAGGG - Intergenic
1111043003 13:82775523-82775545 AAGAACTTCATCTATTAGCATGG - Intergenic
1113348175 13:109501237-109501259 GAGGACTGCTCCAATTACCATGG - Intergenic
1114573067 14:23688869-23688891 GAGAACTTCCCAACCTAGCAAGG - Intergenic
1117811632 14:59553057-59553079 GAGAACTTCCCAACCTAGCAAGG + Intronic
1118615679 14:67573039-67573061 GAGGTCTTCCCCAGCTAGCATGG + Intronic
1123225041 15:17015192-17015214 GAGAACTTCCCCAATCTAGAAGG + Intergenic
1125156306 15:36590509-36590531 CAGAATTGCCTCAATTAGCAGGG - Intronic
1126516670 15:49546874-49546896 GAGAACTCCCCCATCTAGCAAGG + Intronic
1137325576 16:47431910-47431932 GAGAATTCCCCCATTTACCAAGG + Intronic
1146563719 17:33893877-33893899 GAGAGGGTCACCAATTAGCATGG - Intronic
1147716136 17:42510009-42510031 TAGAACTTCCCCATTTTGCTTGG + Intronic
1150810221 17:68350412-68350434 GAAACCTTCCCCAATTACCCAGG - Intronic
1154288435 18:13083169-13083191 GAGAACTTCCCCACCTAGCAAGG - Intronic
1155335295 18:24757336-24757358 CAGCACTTCCCCAATTTGCTGGG + Intergenic
1155805103 18:30159823-30159845 GAGAACTTCCATAATTAAAAGGG + Intergenic
1156631299 18:38972590-38972612 CAGAACTTCCCTAGTTTGCATGG + Intergenic
1159409673 18:68055072-68055094 GAGATCTTCCCCCTCTAGCACGG + Intergenic
1160289640 18:77579341-77579363 GAGAACTTCCCAACCTAGAAAGG + Intergenic
1161807223 19:6451566-6451588 CAGGTCTCCCCCAATTAGCATGG - Intronic
1164667351 19:30050376-30050398 GAGAAATTCCCCCATGGGCATGG - Intergenic
1165151903 19:33765978-33766000 GTGAAGTTCCCCAAGTAGGAGGG + Intronic
1165489241 19:36113887-36113909 GAGAACTTCACCAATAGGTAAGG + Intronic
926507746 2:13737810-13737832 GAGAACTTCCCAATCTAGCAAGG - Intergenic
927869723 2:26615875-26615897 GACAACTTCATCAGTTAGCAGGG - Intronic
928218448 2:29382109-29382131 GAGAACTTCCCCAGGTATCTGGG + Intronic
929341716 2:40826959-40826981 AAGCACTTTCCCAATTAGAAAGG + Intergenic
931306744 2:61036224-61036246 GAGAACTTCCCTAACTAGCAAGG + Intronic
931530813 2:63212062-63212084 GAGAACTTCTCCAGCTAGCAAGG + Intronic
936514162 2:113171251-113171273 GAGACCTTCCCGAATTCCCACGG + Intronic
937903228 2:127038491-127038513 AAGATCTTACCCCATTAGCATGG + Intergenic
939097855 2:137855668-137855690 GAGAACTTTCCAAATTAACAAGG + Intergenic
945451011 2:209995332-209995354 GAGAACTTCCCCACTGAAGAAGG + Exonic
946205743 2:218107104-218107126 GAGAACTTCCCCAACTAGAAAGG - Intergenic
948576204 2:238951284-238951306 GAGCACTTTCACAATTACCAAGG + Intergenic
1169858524 20:10128718-10128740 GAGAACTTCCCCTATAACAATGG + Intergenic
1170581071 20:17700065-17700087 CAGAACTTTCCCAAGCAGCATGG + Intronic
1170730866 20:18973689-18973711 GAGCAGTTCCCCAAGCAGCATGG - Intergenic
1171120369 20:22563420-22563442 AAAGACTTCCCCTATTAGCATGG + Intergenic
1172149745 20:32781271-32781293 GAGAAAAGCCCCTATTAGCAAGG + Intronic
1174096279 20:48092171-48092193 GACATCATCCCTAATTAGCATGG - Intergenic
1176417005 21:6481976-6481998 CAGATTTTCTCCAATTAGCAGGG + Intergenic
1179692503 21:43090309-43090331 CAGATTTTCTCCAATTAGCAGGG + Intergenic
1180244872 21:46540222-46540244 GAGTGCTTCCCAAATTAGAAAGG + Intronic
1181287591 22:21765365-21765387 GAGAACTTTCCCAAGGAGCAAGG + Intronic
1183005599 22:34899024-34899046 GAGAACATGCCCAGGTAGCATGG + Intergenic
949287901 3:2428621-2428643 GAGAACTTCCCCAACTAGCAAGG - Intronic
951759413 3:26129037-26129059 GAGAACTTCCCCAACGAGCAAGG - Intergenic
952160758 3:30691038-30691060 GAGAACTTCTCTAAATAGAAAGG + Intronic
954639694 3:52090645-52090667 GAAAACTTCTCCAGTGAGCAGGG - Intronic
954845465 3:53551883-53551905 GAGAATTTCCCCATTCACCATGG - Intronic
957858170 3:85906488-85906510 GATAACTATCCCACTTAGCAAGG - Intronic
960156776 3:114304662-114304684 CAGCACTTCCTCCATTAGCATGG + Intronic
960684384 3:120282502-120282524 GGGAACATGCCCAATTAACAAGG + Intronic
964715405 3:159715843-159715865 GAGAACTTCCTCACCTAGCAAGG + Intronic
965448910 3:168812496-168812518 GAGCACTTACCCAATTCTCAGGG - Intergenic
965947781 3:174264232-174264254 GAGAACTTCCCAATCTAGCAAGG - Intronic
969185187 4:5469373-5469395 GAGAACTTCCCCAACCACCCAGG - Intronic
970883571 4:20960620-20960642 GAGAAGGACCCCATTTAGCAGGG + Intronic
971437391 4:26642022-26642044 GAGAACTTCCCTAACTAGCAAGG + Intronic
972917212 4:43896045-43896067 GAGAACTTCCCCACCTAGCAAGG - Intergenic
974063700 4:57057647-57057669 GAGAACATACCCAAAAAGCAAGG - Intronic
975441418 4:74414865-74414887 GAGAACTTCTTCAAATATCAAGG - Intergenic
975887264 4:78980993-78981015 GAGAACTTCCCAATCTAGCAAGG - Intergenic
976210751 4:82667126-82667148 GAGTACTTCACTAACTAGCATGG - Intronic
976790396 4:88871738-88871760 GAGAATTCCCCAACTTAGCAAGG + Intronic
976843045 4:89453789-89453811 GAGATCATCCCCAATTAGAGTGG - Intergenic
976886505 4:89991268-89991290 GAGAAAAGCCCCAAATAGCATGG - Intergenic
980670831 4:136004696-136004718 GAGAGCTTCCCCAAATAAAATGG - Intergenic
981496671 4:145401406-145401428 GAGAACTTCCCCAACCTGCAAGG - Intergenic
987043562 5:14085645-14085667 GAGAACTTGCACAAACAGCACGG + Intergenic
988375259 5:30427923-30427945 GAGAACTTCCCAATCTAGGAAGG - Intergenic
988881142 5:35504195-35504217 AAGAACTTCACCAATGAGCCTGG - Intergenic
989159367 5:38375586-38375608 GAAAGCTTCCCCAGTTAGTAGGG - Intronic
989276631 5:39597687-39597709 GAGAACTTCCCAACCTAACAAGG - Intergenic
989357934 5:40565945-40565967 GAGAACTTCCCTAACCAGCAAGG - Intergenic
989941607 5:50157579-50157601 GAGAACTTCCCAATCTAGCAAGG + Intergenic
990163980 5:52975157-52975179 GAGAACTTCCCAACCTAGCAAGG - Intergenic
990366825 5:55079912-55079934 GAGAACTTCCCCAATCTAGAAGG - Intergenic
993366596 5:87041579-87041601 GAGAACTTCCCAATCTAGCAAGG - Intergenic
993858224 5:93101661-93101683 TAAAGCTTCCCCAATTTGCAAGG + Intergenic
994545781 5:101164448-101164470 GAGAACTTCCCAACCTAGCAAGG + Intergenic
994983249 5:106903537-106903559 GAGAACTCCCCAATCTAGCAAGG - Intergenic
997432821 5:133852807-133852829 GAGAACTTCCCCTACTAGCAAGG + Intergenic
997591805 5:135078284-135078306 GGCAACTTCCCACATTAGCATGG + Intronic
998879438 5:146631585-146631607 GAGAGGTTCCCCAATAAGTAGGG - Intronic
1001423757 5:171609344-171609366 GGCAACTTCCCCCATTAGAAAGG + Intergenic
1003480131 6:6523777-6523799 GACAACTGCCCCAAATAGCAGGG - Intergenic
1006573828 6:35028176-35028198 CAGAACTTCCCCCAAAAGCATGG + Intronic
1010233674 6:73557454-73557476 GATAACTTCCCCAATTACTCTGG + Intergenic
1010540488 6:77087025-77087047 GAGAACTTCCCAATCTAGCAAGG - Intergenic
1011298135 6:85845978-85846000 GAGAACTTCCCAACCTAGCTAGG - Intergenic
1012209137 6:96498818-96498840 GAGAACTTCTCCAACTAGCAAGG - Intergenic
1012388713 6:98711495-98711517 GAGAGCTTCCAAAATTAGCAGGG + Intergenic
1013906300 6:115223651-115223673 GAGAACTTCCCCACCTAGCAAGG + Intergenic
1015247218 6:131087915-131087937 GAGAACTTCCCCAACTAGCAAGG + Intergenic
1015660851 6:135571912-135571934 GGGAACTTTCCCACTTACCAAGG + Intergenic
1023691878 7:42797715-42797737 GAGAACTTCCCCAATATACCAGG + Intergenic
1028013457 7:85678365-85678387 GAGAACTTGCCCACCTAGCAAGG - Intergenic
1028211430 7:88078939-88078961 GAGAACTTCCCAATCTAGCAAGG + Intronic
1029059976 7:97787180-97787202 GAGAGCTTCCCCAATCTACAAGG + Intergenic
1029936297 7:104427977-104427999 GAGAACTTCTCTAATTAAAATGG + Intronic
1031007394 7:116488992-116489014 GAGAATTTCCCCCAAAAGCATGG - Intronic
1034379679 7:150679935-150679957 GAGAGCTTCCCAATCTAGCAAGG + Intergenic
1037781394 8:21871682-21871704 GAGAGCCTCCCCAATTAGCCGGG + Intergenic
1038141592 8:24850922-24850944 TAGACTTTCACCAATTAGCAGGG + Intergenic
1040737426 8:50525985-50526007 AAGAACTTCACCAATCAGCCTGG + Intronic
1040814586 8:51493873-51493895 GAGAACTTCCCAATCTAGCAAGG + Intronic
1042638463 8:70905169-70905191 GAGAACATCCCAACCTAGCAAGG - Intergenic
1042763197 8:72292622-72292644 GAGAACTTCCCCAACCAGCAAGG + Intergenic
1044073898 8:87794726-87794748 GAGAACTTCCCCAACTAGTAAGG + Intergenic
1044334709 8:90966951-90966973 CAGATGTTCCCCAATTAGGATGG - Intronic
1044403141 8:91795008-91795030 GAGAACTTCCCCATCTGGCAAGG + Intergenic
1045018253 8:98018279-98018301 GAGAAATTCCCGAAAAAGCAAGG - Intronic
1046631090 8:116623794-116623816 GATAACTACCCCAGTTACCATGG + Intergenic
1047141216 8:122141794-122141816 GAGAAGTCACCCTATTAGCAAGG - Intergenic
1056934299 9:90903972-90903994 AAAAACTTTCCCAAGTAGCAGGG - Intergenic
1057539154 9:95948690-95948712 AAGACCTTCACTAATTAGCAGGG - Intronic
1058199908 9:102026785-102026807 GAGAACTTCCTAACCTAGCAAGG - Intergenic
1185543954 X:926696-926718 GAGATCATCCCGAATTAGGATGG - Intergenic
1191203941 X:57814954-57814976 GAGAACTTCACAACCTAGCAAGG - Intergenic
1192678991 X:73231439-73231461 GAGAAATTCCCAATCTAGCAAGG + Intergenic
1193036010 X:76951944-76951966 GAGAACTTCCCCAACCTGCAAGG + Intergenic
1193146414 X:78080911-78080933 GAGAACTTCCCCAACCAGCAAGG - Intronic
1195018808 X:100805261-100805283 AAGACCTTCACTAATTAGCAGGG - Intergenic
1201971162 Y:19796919-19796941 GAGAACTTCCCCAACAAACAAGG - Intergenic