ID: 905841258

View in Genome Browser
Species Human (GRCh38)
Location 1:41180978-41181000
Sequence TGGTAGTGATACCAAAACAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 4, 2: 79, 3: 47, 4: 123}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905841254_905841258 22 Left 905841254 1:41180933-41180955 CCTGACTTCAAACTATACTACAA 0: 13048
1: 7611
2: 6134
3: 4840
4: 3817
Right 905841258 1:41180978-41181000 TGGTAGTGATACCAAAACAGAGG 0: 1
1: 4
2: 79
3: 47
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905841258 Original CRISPR TGGTAGTGATACCAAAACAG AGG Intronic