ID: 905841258 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:41180978-41181000 |
| Sequence | TGGTAGTGATACCAAAACAG AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 254 | |||
| Summary | {0: 1, 1: 4, 2: 79, 3: 47, 4: 123} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 905841254_905841258 | 22 | Left | 905841254 | 1:41180933-41180955 | CCTGACTTCAAACTATACTACAA | 0: 13048 1: 7611 2: 6134 3: 4840 4: 3817 |
||
| Right | 905841258 | 1:41180978-41181000 | TGGTAGTGATACCAAAACAGAGG | 0: 1 1: 4 2: 79 3: 47 4: 123 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 905841258 | Original CRISPR | TGGTAGTGATACCAAAACAG AGG | Intronic | ||