ID: 905842158

View in Genome Browser
Species Human (GRCh38)
Location 1:41190730-41190752
Sequence CCCCATATCACACTTCTGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 107}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905842158 Original CRISPR CCCCATATCACACTTCTGTA AGG (reversed) Intronic
901184818 1:7366156-7366178 CCCCAAATCACACTGCTTTCTGG - Intronic
901535133 1:9877848-9877870 CCCCACCCCACACTACTGTATGG + Intronic
902271253 1:15306800-15306822 CCCCACAGCAAACTTCTGCATGG - Intronic
905842158 1:41190730-41190752 CCCCATATCACACTTCTGTAAGG - Intronic
908992233 1:70105622-70105644 CCACATATCATTCTACTGTATGG + Intronic
909067536 1:70953508-70953530 CCCCATATAACATGTCTGTTGGG - Intronic
909418518 1:75434943-75434965 CCCCATATTACAGTTAGGTATGG + Intronic
909432258 1:75602673-75602695 CCTCTTATCACACTTTTGTTTGG - Intronic
909479762 1:76118730-76118752 CCCCAAATCATATTTCTATAAGG + Intronic
913684220 1:121216114-121216136 CCCCATGTCACAGTGCTGCATGG + Intronic
915730515 1:158050522-158050544 CCCCATCCCACAGTTCTGCAAGG - Intronic
916350767 1:163847316-163847338 CCCCAAAACACACTTCTAAAAGG + Intergenic
919018601 1:192073960-192073982 CTCCATATCAGTCTTCTGTATGG - Intergenic
920783718 1:209020331-209020353 CCCCATAGCAAACTTCTGCCTGG - Intergenic
1065679653 10:28215764-28215786 ACCCTTATAACAATTCTGTAAGG - Intronic
1066440719 10:35436117-35436139 CCCCATGTCACACTTCCCCATGG - Intronic
1073919833 10:108445972-108445994 CTCCATAACACACTTTTGTTTGG + Intergenic
1075368837 10:121917499-121917521 CCCAAAATCACACTTCTGAATGG + Intronic
1075489092 10:122850828-122850850 CCGCATATCACACCTGTGAAAGG - Intronic
1076075559 10:127531181-127531203 CCCCATATCACCTCTCTATAGGG - Intergenic
1077178090 11:1199627-1199649 CCCCATCCCTCACTTCTGTGGGG + Intronic
1078698803 11:13661231-13661253 TCACACATCACACTGCTGTAAGG - Intergenic
1082229419 11:49745191-49745213 CCCCATAGCAAACTTCTGCCTGG + Intergenic
1083106527 11:60363569-60363591 CCCCAGCACACACTTATGTAAGG - Intronic
1084771295 11:71344336-71344358 CCCCTTCTCAGACTCCTGTACGG + Intergenic
1085384470 11:76149223-76149245 CCCCATAGCACAATGCTGTGAGG - Intergenic
1086620665 11:88883931-88883953 CCCCATAGCAAACTTCTGCCTGG - Intronic
1092106385 12:5924561-5924583 CCCCATATCACTCTGCCGAAAGG + Intronic
1092891171 12:12970591-12970613 CCCCATCTCACTCCTCTCTAGGG - Intergenic
1095438528 12:42218573-42218595 CCCCAAATCACAATCCTGAAAGG - Intronic
1098367687 12:69722255-69722277 CCACCTATCACACTTCTGGTCGG + Intergenic
1099269964 12:80496442-80496464 CCCTCTATAACATTTCTGTAAGG + Exonic
1099526780 12:83726489-83726511 CCCCACATCAAACTTCTGCCTGG - Intergenic
1105019856 12:132808834-132808856 CTCCTCATCAGACTTCTGTAGGG + Intronic
1108273663 13:48787137-48787159 CCCCAAATCACACTTCAGAGGGG + Intergenic
1109214177 13:59568836-59568858 CCTAATATCACAGTTCTATAGGG - Intergenic
1109749592 13:66672417-66672439 CCCCATAGCACACCTCTGCCTGG - Intronic
1110816626 13:79867430-79867452 CCCCTTAGCACACTGCTGTGGGG + Intergenic
1114229901 14:20771700-20771722 CCCCAAATCACATTTCTTTAAGG + Intergenic
1114991877 14:28298105-28298127 CCCCATAGCAGACTTCTGCCTGG - Intergenic
1115673585 14:35644472-35644494 CCCCCTTTCCCACTTCAGTATGG - Intronic
1119182890 14:72616161-72616183 CCTCATTTCACATGTCTGTAAGG - Intergenic
1124155682 15:27223608-27223630 CCACTTCTCACATTTCTGTAGGG + Intronic
1125418076 15:39474236-39474258 CCCTATATCTCCCTTCTCTAGGG - Intergenic
1126211306 15:46104017-46104039 CCCCTAATAACACTTCCGTATGG - Intergenic
1131069312 15:89455334-89455356 CCACATATCACACATTTGTTTGG - Intergenic
1139094157 16:63684543-63684565 TCCCAGTTCCCACTTCTGTATGG + Intergenic
1141916425 16:87100430-87100452 CCCCATGTCACACTTAGGTGAGG + Intronic
1143879627 17:10019983-10020005 CCCAATGTCACGCTACTGTAGGG - Intronic
1145852917 17:28120811-28120833 AACCATATCAAACTTCTTTATGG - Intronic
1146411499 17:32589518-32589540 TCCCCTGTCACACTTCTGCATGG - Intronic
1155043906 18:22087437-22087459 TCCCATTTCACTCTTCTGGAGGG + Intergenic
1155366551 18:25054971-25054993 CCCCTTATCCCCCTTGTGTATGG - Intergenic
1158708065 18:59811950-59811972 CCCCATATTTCACTTTAGTAAGG + Intergenic
1158924764 18:62244335-62244357 CCACTTTTCCCACTTCTGTAAGG - Intronic
1162101278 19:8340716-8340738 CTCCATTTCCCACTTCTGTCTGG + Intronic
1166607512 19:44157967-44157989 CCACATATCTCACATTTGTAAGG - Exonic
927410360 2:22817928-22817950 CCCCAGATAACCCCTCTGTAGGG - Intergenic
931119623 2:59201608-59201630 ACCCATCTCCCACTTCTGTGAGG + Intergenic
931754180 2:65357526-65357548 CCCCCGATCACACTTTTGAAAGG + Intronic
935896526 2:107743953-107743975 CCACTTGTCACACTTTTGTATGG + Intergenic
942987369 2:182159593-182159615 TTCCATAGCACACTTCTTTAAGG + Intronic
943931400 2:193858213-193858235 CCCCATAGCAGACAACTGTAGGG - Intergenic
944858144 2:203787843-203787865 CCCCATAACCCACTTCTGTCAGG + Intergenic
945544748 2:211137163-211137185 AACCATATCACACCCCTGTAGGG + Intergenic
1171405490 20:24909763-24909785 CCCCTTGCCTCACTTCTGTAGGG + Intergenic
1179292543 21:40031223-40031245 CCCCACATCACTGTTCTCTAAGG - Intronic
1185210205 22:49566462-49566484 CCCCACATCCCACTGCTGCACGG + Intronic
955990885 3:64626183-64626205 CTCCTTATCACACTTCTATAAGG + Intronic
956757810 3:72406462-72406484 CTCCATATGACACTTGTGTCAGG - Intronic
958637471 3:96763520-96763542 CCCCATAGCAAACTTCTGCCTGG - Intergenic
960255938 3:115511806-115511828 TCTCCAATCACACTTCTGTATGG - Intergenic
962486465 3:135847502-135847524 CCCCCTTTCACACTTCTGCCAGG + Intergenic
964585654 3:158297030-158297052 CCCCACATCTCACTTCTCTGAGG - Intronic
969859586 4:10025042-10025064 CTCCATTTCACACCTCTGTGGGG + Intronic
969993052 4:11283869-11283891 CCCCATAGCAAACTTCTGCCTGG + Intergenic
972123237 4:35731961-35731983 TCCCCTATCTCACTTCTGAAGGG - Intergenic
972707826 4:41562728-41562750 CCCTGTATCTCCCTTCTGTAGGG + Intronic
976497954 4:85752165-85752187 CCCCATACCACTCACCTGTAAGG - Intronic
976787986 4:88844469-88844491 GGCTATATCACACTTCTGTCAGG - Intronic
978377526 4:108091235-108091257 CCCCAAAACACACTTGTGTATGG + Intronic
988808612 5:34763730-34763752 CCTCATATCACACTTCAGGCAGG - Intronic
989990268 5:50755445-50755467 CCCCATTTCTCACTTTTGTCAGG + Intronic
991253702 5:64592225-64592247 TACCATATCAAACTTCTGCAGGG + Intronic
993622102 5:90180600-90180622 CACCATATCAGACTTATGTCTGG + Intergenic
996306580 5:122054037-122054059 CTCCATCTCACACTGCTGGATGG - Intronic
996644464 5:125797183-125797205 CTACATATCACACTGCAGTAAGG - Intergenic
996930126 5:128876403-128876425 CCCAATTTCAAACTTCTGAAAGG + Intronic
1008486387 6:52040739-52040761 ACCCATATCTCCCTTCTCTAAGG + Intronic
1010536623 6:77038731-77038753 CCCCACATCAGACTTCTGCCTGG - Intergenic
1012207654 6:96480410-96480432 CCCCATCTCACAGTTGTCTATGG + Intergenic
1015707924 6:136108590-136108612 CCACATAGCACTCTTCAGTATGG + Intronic
1016086406 6:139920555-139920577 CACGATAACACAATTCTGTAGGG - Intergenic
1023105220 7:36757135-36757157 TCCCACATCCCACTTCTGCATGG - Intergenic
1024709138 7:51995839-51995861 CCCCAGATCAGTCTTCTGGAAGG + Intergenic
1025190706 7:56893527-56893549 CCTCAGGCCACACTTCTGTAGGG + Intergenic
1027605342 7:80292622-80292644 CCCCAAAGCAAACTTCTGCACGG + Intergenic
1027642277 7:80751201-80751223 CTCCGTATCACATTTCAGTAAGG - Intronic
1029964075 7:104720267-104720289 CCCCATTTCTCATTTCTGTCAGG - Intronic
1030979122 7:116165470-116165492 ACCCATATCCAACTTCAGTATGG + Intergenic
1031586661 7:123538778-123538800 CCCCACAATACACTTGTGTAGGG + Exonic
1034565524 7:151911545-151911567 CTCCATATCACATATCTCTATGG - Intergenic
1035449275 7:158965194-158965216 CTCCATCTCACACTGCTATAAGG + Intergenic
1038031268 8:23643558-23643580 CCCCATCTCACAATTTTGTTAGG + Intergenic
1038664015 8:29521799-29521821 CCTCTTTTCACACTTCTGTATGG - Intergenic
1041737498 8:61126989-61127011 CCCCATCTCACACTGCAGGAAGG - Intronic
1043056846 8:75450083-75450105 TCACAGATCACACTTCTGTGTGG - Intronic
1047282862 8:123460930-123460952 GCACATTTCACACTTCTGTCAGG + Intronic
1056618764 9:88192676-88192698 TCCCATCTCACCCTTCCGTAAGG + Intergenic
1056646914 9:88420826-88420848 CCCATTATCACATTTCTTTAAGG + Intronic
1059619492 9:115987781-115987803 CCCCATTTCACAGTACTGTAGGG + Intergenic
1061043326 9:128151793-128151815 CCCCATACAACACATCTGTGTGG - Intronic
1191211448 X:57889337-57889359 CCCTGTATCACACTTCTGCCTGG + Intergenic
1195020338 X:100820369-100820391 CGCCAAAGCACACTTCCGTACGG - Intronic
1195608783 X:106839738-106839760 CCCCAAATCACATCTATGTAAGG - Intronic
1196547151 X:116975648-116975670 TCCATTATCACACTACTGTAAGG - Intergenic