ID: 905846832

View in Genome Browser
Species Human (GRCh38)
Location 1:41241392-41241414
Sequence CCCGTTTCCGGCGGGGCACT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 35
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 33}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905846819_905846832 15 Left 905846819 1:41241354-41241376 CCGCTGTGGCTCACTTCGGTGCG 0: 1
1: 0
2: 0
3: 1
4: 49
Right 905846832 1:41241392-41241414 CCCGTTTCCGGCGGGGCACTGGG 0: 1
1: 0
2: 0
3: 1
4: 33
905846815_905846832 23 Left 905846815 1:41241346-41241368 CCCCAGGGCCGCTGTGGCTCACT 0: 1
1: 0
2: 1
3: 25
4: 196
Right 905846832 1:41241392-41241414 CCCGTTTCCGGCGGGGCACTGGG 0: 1
1: 0
2: 0
3: 1
4: 33
905846816_905846832 22 Left 905846816 1:41241347-41241369 CCCAGGGCCGCTGTGGCTCACTT 0: 1
1: 0
2: 1
3: 9
4: 131
Right 905846832 1:41241392-41241414 CCCGTTTCCGGCGGGGCACTGGG 0: 1
1: 0
2: 0
3: 1
4: 33
905846817_905846832 21 Left 905846817 1:41241348-41241370 CCAGGGCCGCTGTGGCTCACTTC 0: 1
1: 0
2: 2
3: 19
4: 169
Right 905846832 1:41241392-41241414 CCCGTTTCCGGCGGGGCACTGGG 0: 1
1: 0
2: 0
3: 1
4: 33
905846814_905846832 24 Left 905846814 1:41241345-41241367 CCCCCAGGGCCGCTGTGGCTCAC 0: 1
1: 0
2: 2
3: 17
4: 216
Right 905846832 1:41241392-41241414 CCCGTTTCCGGCGGGGCACTGGG 0: 1
1: 0
2: 0
3: 1
4: 33

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905846832 Original CRISPR CCCGTTTCCGGCGGGGCACT GGG Intronic
905846832 1:41241392-41241414 CCCGTTTCCGGCGGGGCACTGGG + Intronic
1065818110 10:29500313-29500335 CCTGTTTATGGCGAGGCACTGGG + Intronic
1069454218 10:68540979-68541001 CCCTTTCCTGGTGGGGCACTAGG + Intergenic
1069547226 10:69337419-69337441 CCTGCTTCCTGCGTGGCACTTGG + Intronic
1077976557 11:7252904-7252926 CCCGTTCCCGGCGGGTCGCACGG + Intronic
1122066318 14:99176305-99176327 CCCCTGTCAGGCAGGGCACTGGG - Intronic
1132535599 16:477977-477999 CCCGTTTGCGGCAGGGCTCCAGG + Intronic
1132544544 16:527343-527365 TCCGTGTCCCGCGGGGCTCTGGG - Intergenic
1132666001 16:1081599-1081621 CCCGCTTCCTGCTGGGCATTTGG - Intergenic
1132893052 16:2214046-2214068 CCCGGTACCTGCGGGGCACAGGG + Exonic
1133126765 16:3652297-3652319 GCAGCTTCCGGCGGGGCACAGGG - Intronic
944210423 2:197201388-197201410 CCCGTTGCCTCCGTGGCACTAGG + Intronic
947220042 2:227782986-227783008 CACGTTTCCATCGGGGCTCTGGG + Intergenic
947412217 2:229852758-229852780 CAAGTTCCCGGCGAGGCACTAGG - Intronic
1175486851 20:59353120-59353142 CCCATTTCCGGCAGCTCACTGGG + Intergenic
1178914309 21:36698413-36698435 CCTGTTTCCGCCGGCGCCCTGGG + Intergenic
1179378789 21:40879233-40879255 TCCGTTTCCAGCTGGGAACTTGG + Intergenic
954450536 3:50569149-50569171 CCCCTTTCCGGCAGGCTACTGGG + Intronic
960871810 3:122257396-122257418 GCCTTCTCAGGCGGGGCACTGGG + Intronic
968593731 4:1472205-1472227 CCCGTGTCCCGCGGGGCAGCCGG + Intergenic
983577069 4:169271209-169271231 CCGGGCTCCGGCGGGGTACTGGG - Intergenic
985832004 5:2240710-2240732 CCAGTTTCCGGCCTCGCACTGGG - Intergenic
996398616 5:123036457-123036479 CCTGTTGCGGGCGGGGCCCTGGG - Intronic
1002455544 5:179344149-179344171 CCCGTTGCAGGCGGGCCCCTGGG - Exonic
1002712872 5:181205415-181205437 CCCGTTTCCCGCGGCTGACTGGG - Intergenic
1023418080 7:39950559-39950581 CCCGTTTCCGGCGGGGGAGATGG + Exonic
1035742974 8:1943179-1943201 CCCCTTTCCGGCTGGGCTGTAGG - Intronic
1038146160 8:24898126-24898148 CCATTTTCCGGAGGGTCACTGGG - Intergenic
1051647219 9:19280431-19280453 GCCCCTTCCGGCGGGGCACAGGG - Intronic
1058530772 9:105902757-105902779 CCTGCTTCCTGCAGGGCACTAGG + Intergenic
1061883206 9:133578224-133578246 CCTGTTTCTGGCTGAGCACTGGG + Intergenic
1061903486 9:133684830-133684852 CCCGTTTCCAGGAGGTCACTTGG + Intronic
1062030818 9:134361195-134361217 ACCTTTTCCGGTTGGGCACTGGG + Intronic
1196303625 X:114074188-114074210 TCTGTTTCCCGAGGGGCACTGGG - Intergenic
1198511377 X:137355033-137355055 GCCCTTTCCAGCTGGGCACTGGG + Intergenic