ID: 905847462

View in Genome Browser
Species Human (GRCh38)
Location 1:41244355-41244377
Sequence CTGTAGCCTTAGATAAGGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 111}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905847457_905847462 26 Left 905847457 1:41244306-41244328 CCTCTTTTCTAGGCTGAAAGCGT 0: 1
1: 0
2: 0
3: 8
4: 89
Right 905847462 1:41244355-41244377 CTGTAGCCTTAGATAAGGCTTGG 0: 1
1: 0
2: 1
3: 15
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905847462 Original CRISPR CTGTAGCCTTAGATAAGGCT TGG Intergenic
902322041 1:15674937-15674959 CTGGTTCCATAGATAAGGCTTGG - Intergenic
902447722 1:16477584-16477606 TTGTAGCCTTAAAACAGGCTGGG - Intergenic
903073499 1:20742848-20742870 CTGTAGCCTAAAGTATGGCTGGG - Exonic
903994796 1:27298976-27298998 CTGATGCCTTAGCTAAGGCCGGG - Intronic
905847462 1:41244355-41244377 CTGTAGCCTTAGATAAGGCTTGG + Intergenic
911761071 1:101618031-101618053 CTATGACATTAGATAAGGCTGGG - Intergenic
913478472 1:119261693-119261715 CTGTAACCATAGATGAGGATGGG - Intergenic
917268195 1:173243906-173243928 CTGTCACCTTAGAGTAGGCTAGG + Intergenic
918047590 1:180950887-180950909 CTGTAGCCTTTGACCAGGCATGG - Exonic
921561119 1:216659540-216659562 CTGTGGCAAGAGATAAGGCTGGG - Intronic
922355967 1:224775292-224775314 CTGGAGCCTTGGAAGAGGCTTGG - Intergenic
923807263 1:237271240-237271262 CTGTAGCTTAAGATATTGCTGGG - Intronic
1063138647 10:3238148-3238170 CGATAGCCTTAGAATAGGCTAGG + Intergenic
1065574268 10:27102379-27102401 CTTTAGCCTTAGATAGGCATGGG - Intergenic
1067664145 10:48259100-48259122 CTGAAGCCTTAGAGAAGGACAGG - Intronic
1069541233 10:69295617-69295639 CTGTAGCCTTAGAGAAAGACAGG - Exonic
1070672612 10:78388608-78388630 CTGCAGGTTTAGACAAGGCTTGG + Intergenic
1071080559 10:81805100-81805122 ATATAGCCTTAGATAAGGCTTGG - Intergenic
1072037122 10:91573734-91573756 CTGTATCCTTTGATAAGGTATGG - Intergenic
1072077160 10:91988539-91988561 CTGTAGCCTTAGATAGCTCTTGG + Intronic
1072339242 10:94430535-94430557 CTTTAGCCTTTGATAAGGTATGG + Intronic
1073068765 10:100780358-100780380 CTGTAGCCATAGATGAGGCCCGG + Intronic
1075325856 10:121531701-121531723 CTATGGCCTTAGAAAAGGCATGG - Intronic
1076042113 10:127259160-127259182 CTGTAGCCTTAGCTCTGGCCCGG + Intronic
1078548894 11:12267083-12267105 CTGTTGCCTTTAAGAAGGCTGGG - Intergenic
1081273709 11:41120614-41120636 CTGTAGCTTCAGAAAAGACTAGG - Intronic
1081450162 11:43163336-43163358 CTGTAGCCTTACATAGGCCTCGG - Intergenic
1083968119 11:66055368-66055390 GTGGAGCCTTAGAGAAAGCTGGG + Intronic
1084208848 11:67611671-67611693 CTGCAGCCTGAGATAAAGCAAGG + Intronic
1085418379 11:76335064-76335086 CAGTAGCCTGAGATACAGCTTGG - Intergenic
1086502638 11:87469280-87469302 ATGTAGCCTTAGATATTGATGGG - Intergenic
1086957155 11:92945191-92945213 CTGTAGCCTTACATGGGCCTTGG - Intergenic
1094298741 12:28937018-28937040 CTGTGGCCTTGGAAAAGTCTTGG + Intergenic
1095451529 12:42336585-42336607 CTTTGGGCTTAGAAAAGGCTTGG - Intronic
1098166704 12:67705900-67705922 CTCTATCCTTAGATAAGGACAGG + Intergenic
1099494124 12:83324066-83324088 CTGCAGCCTTACATAGTGCTTGG - Intergenic
1101104161 12:101423702-101423724 CTTTAGCCTTACAAAATGCTGGG - Intergenic
1105993669 13:25649338-25649360 CAGTAGCCTCAGATCAGGCCAGG + Intronic
1106618758 13:31354205-31354227 CTGTTGCCATAGGTAAGGGTAGG - Intergenic
1107973823 13:45670231-45670253 CTGTAGGTTTAGAAAAGACTTGG + Intergenic
1109843554 13:67952904-67952926 CTCTAGCCTTAGAGATGGTTGGG - Intergenic
1110773014 13:79371983-79372005 AAATAGCCTTAGATAGGGCTGGG + Intronic
1110880239 13:80562838-80562860 CTGTAAGCATAGATCAGGCTGGG + Intergenic
1113755788 13:112809735-112809757 CAGGTGCCTTAGATAAGGATGGG - Intronic
1116858018 14:49970686-49970708 CTGGAGCCTGAGATAAGGTCAGG + Intergenic
1117543314 14:56769679-56769701 CTGTAGCCAGAGATGAGGCCAGG - Intergenic
1119701549 14:76759108-76759130 CTTTTGGCTTAGATAAGACTGGG + Intergenic
1119751752 14:77083664-77083686 CTGTAGTCTGAGACCAGGCTGGG - Intergenic
1122429431 14:101630470-101630492 GTGAGGCCTTAGACAAGGCTGGG - Intergenic
1125249295 15:37681270-37681292 CTGTAGCCTCAGAGAACACTAGG - Intergenic
1126433786 15:48614644-48614666 CTCTATCCTTAGAGAAGGCCTGG - Intronic
1127310852 15:57751021-57751043 GTGTAGCTTTAGATAAGCCACGG + Intronic
1129366366 15:75057935-75057957 GTGGAGCCCTAGATAAGACTTGG + Intronic
1129567597 15:76639972-76639994 CTGTAGCCATACATAGGCCTTGG + Intronic
1132496813 16:267169-267191 CTGTGGCCTTAGGGCAGGCTGGG + Intronic
1133746308 16:8689378-8689400 CTGTAGCCTTAGAATATGATAGG + Intronic
1134138816 16:11698682-11698704 CTGTTCCCTTAGATATGTCTTGG - Intronic
1139206331 16:65032602-65032624 CTGCAGACTTAGAGAACGCTTGG - Intronic
1139451023 16:67028549-67028571 CTGGGGCCTTAGATAAGAATTGG - Intergenic
1142176053 16:88646001-88646023 CTGTAGGCTGAGCCAAGGCTGGG - Intronic
1144628939 17:16860413-16860435 GTGTATCCTTAGCTCAGGCTGGG + Intergenic
1144652470 17:17015702-17015724 GTGTATCCTTAGCTCAGGCTGGG - Intergenic
1145160513 17:20570980-20571002 GTGTATCCTTAGCTCAGGCTGGG + Intergenic
1147445652 17:40473814-40473836 CTGTAGCCTGAGAGCAGGCAGGG + Intergenic
1149224380 17:54452525-54452547 CTGTAGCAGTAGATAAGTCTTGG + Intergenic
1157213356 18:45762394-45762416 CTAAAGCATTAGAAAAGGCTTGG + Intergenic
1160665977 19:328495-328517 CTGTAGCCTTCCAAAATGCTGGG - Intronic
1161851147 19:6738780-6738802 CTGCAGCCTCAGACAAGGCTGGG - Intronic
925195798 2:1924350-1924372 CTGTACCCTTAGATTAGATTTGG + Intronic
927452207 2:23218588-23218610 CTGTAGTCTTGGAAATGGCTTGG - Intergenic
935659197 2:105450977-105450999 CAGAAGCCTTAGATAAGGGAAGG + Intergenic
939916862 2:148055874-148055896 CTGTAAGTTTAGATAAGTCTTGG + Intronic
939962242 2:148575580-148575602 CTGGGGCCTTTGATAAGGCTGGG - Intergenic
939967290 2:148622933-148622955 CTGTAGCCTAAATTAAGGCTAGG + Intergenic
941129771 2:161632698-161632720 CTGTAGGCTTAAATAAGGCCTGG - Intronic
941894674 2:170617281-170617303 CTGTAGCCTTACATAGGCCTTGG - Intronic
947709519 2:232303932-232303954 CTCTAGCCTTAGAGAAGGCAGGG - Intronic
1173046578 20:39518224-39518246 CTGAAGCCATAAATAAGGCTGGG - Intergenic
1182117358 22:27764544-27764566 CTGTAGCCTCAGAGAGGACTTGG - Intronic
949757085 3:7424408-7424430 CTGTTGCCTTATATCATGCTAGG + Intronic
955750647 3:62183041-62183063 GTGTGGCCTTGGATAAAGCTTGG - Intronic
955892967 3:63669808-63669830 CTGTAGCATGAAATAAGCCTGGG - Intronic
956608702 3:71099936-71099958 CTGTAACCTTAAATGAGACTGGG - Intronic
960324489 3:116278624-116278646 CTGTGGCCTTAGATAATGACAGG + Intronic
962295516 3:134181035-134181057 CTGTAGCCTTAAAGATGTCTTGG - Intronic
965192288 3:165547303-165547325 CCGTAGCCTTACATAGGCCTTGG + Intergenic
967640607 3:191858172-191858194 TTGTACCCTTAGATAAGATTAGG - Intergenic
968726739 4:2251355-2251377 CTGTAGCCTTGGCTAGGTCTTGG - Intronic
969274466 4:6125404-6125426 CTGTAGCCATAGATGGAGCTGGG - Intronic
972552142 4:40143772-40143794 GTGTATCCTTTGATAATGCTGGG - Intronic
978145809 4:105369947-105369969 ATGTAGCTTTATATAAGGCTTGG - Intronic
978285983 4:107077125-107077147 CTTTAGCCCTAGATAAAACTGGG + Intronic
978544540 4:109857007-109857029 CTGTAGCCTTACATAGGCCTTGG - Intronic
984665777 4:182427584-182427606 CTATAGCCATAGATAAAGATGGG - Intronic
988193522 5:27969523-27969545 CTGAAGCCTTAGGCAAAGCTTGG - Intergenic
989121462 5:38008640-38008662 CTGATGCCATATATAAGGCTAGG + Intergenic
992246411 5:74828586-74828608 GTGGAGCCTTAGAAAAGGATTGG - Intronic
995632019 5:114144550-114144572 CCGTAGCCTTACATAGGCCTTGG - Intergenic
996364720 5:122688986-122689008 CTAAAGACTTAGATAAGGCCGGG + Intergenic
997038228 5:130218746-130218768 CTGTCACCTTAGGTCAGGCTGGG + Intergenic
1004246599 6:13983636-13983658 CTGAAGCTTTAGACAAGGGTTGG - Intergenic
1006363367 6:33599873-33599895 CTGAGGCCTTAGATGTGGCTGGG + Intergenic
1008272149 6:49502856-49502878 CCGTAGCCTTACATAGGCCTTGG - Intronic
1010400856 6:75443742-75443764 CTGTCGCCTTAGACAAGGTATGG + Intronic
1012808308 6:103924298-103924320 CTGTAGCCTTATATAATTTTAGG - Intergenic
1014405708 6:121047727-121047749 CTGTAGCCTTACATAGGCCTTGG + Intergenic
1014995258 6:128135184-128135206 ATTTAGTCTTAGATAAGGCAAGG + Intronic
1016723383 6:147329157-147329179 CTCTATCCTTAGATAAATCTAGG - Intronic
1019906514 7:4069118-4069140 CTCTAGCCTCAGATGAGGCTGGG + Intronic
1020398003 7:7739344-7739366 CTGTAGCCTTAGGTGAGATTTGG + Intronic
1021426605 7:20506972-20506994 CTGGAGCCAAAGAGAAGGCTGGG + Intergenic
1021846081 7:24764000-24764022 CTGTATTCTTAGATAACTCTTGG - Intergenic
1022003821 7:26249189-26249211 CTGTAGCTTTTGATGAGGGTCGG - Intergenic
1028155455 7:87424107-87424129 CTGTAGACATAGAAAAGGCATGG + Intronic
1031742748 7:125455247-125455269 TTGGAGCATTAGATAAGGCCTGG - Intergenic
1033657494 7:143383064-143383086 CTGGAGCCGGAGATGAGGCTGGG - Exonic
1034605723 7:152311798-152311820 CTGTAGAATCAAATAAGGCTTGG + Exonic
1035976633 8:4319874-4319896 CTGTAGCCTGAGCTCAGCCTTGG - Intronic
1038767217 8:30440228-30440250 CTGTACACTTAAAAAAGGCTAGG - Intronic
1046720449 8:117612993-117613015 CTCTAGCCTTAGGCAAAGCTAGG - Intergenic
1050467725 9:5948173-5948195 CTTTAGCCTAGGCTAAGGCTTGG - Intronic
1050828984 9:9987614-9987636 CTTTAGCATTAGATATGGTTTGG - Intronic
1052829712 9:33205099-33205121 ATGTAGTCTTAGCTAAGACTAGG + Intergenic
1055781958 9:79830119-79830141 CTTTGGCCTTATGTAAGGCTCGG - Intergenic
1062135099 9:134922630-134922652 CTGCAGCCTGAGATGAGCCTTGG + Intergenic
1193654194 X:84178851-84178873 CTGTAACTTTGGATTAGGCTAGG + Intronic
1200857405 Y:7954080-7954102 CTGTAGTCTTACATAGGCCTTGG - Intergenic
1201622425 Y:15974977-15974999 CTGTAGACTTACATAGGTCTTGG - Intergenic