ID: 905850171

View in Genome Browser
Species Human (GRCh38)
Location 1:41268150-41268172
Sequence CTCCACATCCAGATTGTAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905850171_905850174 -3 Left 905850171 1:41268150-41268172 CCCTCTACAATCTGGATGTGGAG No data
Right 905850174 1:41268170-41268192 GAGGTGAGACTGACATGCAGAGG No data
905850171_905850176 8 Left 905850171 1:41268150-41268172 CCCTCTACAATCTGGATGTGGAG No data
Right 905850176 1:41268181-41268203 GACATGCAGAGGAGGATCAGAGG No data
905850171_905850175 0 Left 905850171 1:41268150-41268172 CCCTCTACAATCTGGATGTGGAG No data
Right 905850175 1:41268173-41268195 GTGAGACTGACATGCAGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905850171 Original CRISPR CTCCACATCCAGATTGTAGA GGG (reversed) Intergenic
No off target data available for this crispr