ID: 905851762

View in Genome Browser
Species Human (GRCh38)
Location 1:41280006-41280028
Sequence TGTGGCGCCACATCTCCCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905851762_905851771 22 Left 905851762 1:41280006-41280028 CCTAAGGGAGATGTGGCGCCACA No data
Right 905851771 1:41280051-41280073 TGCCCCTGACCTCCAGCCCCAGG No data
905851762_905851772 23 Left 905851762 1:41280006-41280028 CCTAAGGGAGATGTGGCGCCACA No data
Right 905851772 1:41280052-41280074 GCCCCTGACCTCCAGCCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905851762 Original CRISPR TGTGGCGCCACATCTCCCTT AGG (reversed) Intergenic