ID: 905851762 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:41280006-41280028 |
Sequence | TGTGGCGCCACATCTCCCTT AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
905851762_905851772 | 23 | Left | 905851762 | 1:41280006-41280028 | CCTAAGGGAGATGTGGCGCCACA | No data | ||
Right | 905851772 | 1:41280052-41280074 | GCCCCTGACCTCCAGCCCCAGGG | No data | ||||
905851762_905851771 | 22 | Left | 905851762 | 1:41280006-41280028 | CCTAAGGGAGATGTGGCGCCACA | No data | ||
Right | 905851771 | 1:41280051-41280073 | TGCCCCTGACCTCCAGCCCCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
905851762 | Original CRISPR | TGTGGCGCCACATCTCCCTT AGG (reversed) | Intergenic | ||