ID: 905851762 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:41280006-41280028 |
| Sequence | TGTGGCGCCACATCTCCCTT AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 905851762_905851771 | 22 | Left | 905851762 | 1:41280006-41280028 | CCTAAGGGAGATGTGGCGCCACA | No data | ||
| Right | 905851771 | 1:41280051-41280073 | TGCCCCTGACCTCCAGCCCCAGG | No data | ||||
| 905851762_905851772 | 23 | Left | 905851762 | 1:41280006-41280028 | CCTAAGGGAGATGTGGCGCCACA | No data | ||
| Right | 905851772 | 1:41280052-41280074 | GCCCCTGACCTCCAGCCCCAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 905851762 | Original CRISPR | TGTGGCGCCACATCTCCCTT AGG (reversed) | Intergenic | ||