ID: 905851765

View in Genome Browser
Species Human (GRCh38)
Location 1:41280024-41280046
Sequence CAGGAGAAGGGGGTTCCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905851765_905851771 4 Left 905851765 1:41280024-41280046 CCACAGGGAACCCCCTTCTCCTG No data
Right 905851771 1:41280051-41280073 TGCCCCTGACCTCCAGCCCCAGG No data
905851765_905851772 5 Left 905851765 1:41280024-41280046 CCACAGGGAACCCCCTTCTCCTG No data
Right 905851772 1:41280052-41280074 GCCCCTGACCTCCAGCCCCAGGG No data
905851765_905851781 26 Left 905851765 1:41280024-41280046 CCACAGGGAACCCCCTTCTCCTG No data
Right 905851781 1:41280073-41280095 GGCCATCAGCCCTGCCAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905851765 Original CRISPR CAGGAGAAGGGGGTTCCCTG TGG (reversed) Intergenic