ID: 905851767

View in Genome Browser
Species Human (GRCh38)
Location 1:41280035-41280057
Sequence AGGGGCATCTGCAGGAGAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905851767_905851772 -6 Left 905851767 1:41280035-41280057 CCCCTTCTCCTGCAGATGCCCCT No data
Right 905851772 1:41280052-41280074 GCCCCTGACCTCCAGCCCCAGGG No data
905851767_905851781 15 Left 905851767 1:41280035-41280057 CCCCTTCTCCTGCAGATGCCCCT No data
Right 905851781 1:41280073-41280095 GGCCATCAGCCCTGCCAATGAGG No data
905851767_905851784 24 Left 905851767 1:41280035-41280057 CCCCTTCTCCTGCAGATGCCCCT No data
Right 905851784 1:41280082-41280104 CCCTGCCAATGAGGAGTGTGAGG No data
905851767_905851771 -7 Left 905851767 1:41280035-41280057 CCCCTTCTCCTGCAGATGCCCCT No data
Right 905851771 1:41280051-41280073 TGCCCCTGACCTCCAGCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905851767 Original CRISPR AGGGGCATCTGCAGGAGAAG GGG (reversed) Intergenic
No off target data available for this crispr