ID: 905851769

View in Genome Browser
Species Human (GRCh38)
Location 1:41280037-41280059
Sequence TCAGGGGCATCTGCAGGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905851769_905851781 13 Left 905851769 1:41280037-41280059 CCTTCTCCTGCAGATGCCCCTGA No data
Right 905851781 1:41280073-41280095 GGCCATCAGCCCTGCCAATGAGG No data
905851769_905851784 22 Left 905851769 1:41280037-41280059 CCTTCTCCTGCAGATGCCCCTGA No data
Right 905851784 1:41280082-41280104 CCCTGCCAATGAGGAGTGTGAGG No data
905851769_905851787 30 Left 905851769 1:41280037-41280059 CCTTCTCCTGCAGATGCCCCTGA No data
Right 905851787 1:41280090-41280112 ATGAGGAGTGTGAGGCCTGCAGG No data
905851769_905851772 -8 Left 905851769 1:41280037-41280059 CCTTCTCCTGCAGATGCCCCTGA No data
Right 905851772 1:41280052-41280074 GCCCCTGACCTCCAGCCCCAGGG No data
905851769_905851771 -9 Left 905851769 1:41280037-41280059 CCTTCTCCTGCAGATGCCCCTGA No data
Right 905851771 1:41280051-41280073 TGCCCCTGACCTCCAGCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905851769 Original CRISPR TCAGGGGCATCTGCAGGAGA AGG (reversed) Intergenic