ID: 905851770

View in Genome Browser
Species Human (GRCh38)
Location 1:41280043-41280065
Sequence TGGAGGTCAGGGGCATCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905851770_905851784 16 Left 905851770 1:41280043-41280065 CCTGCAGATGCCCCTGACCTCCA No data
Right 905851784 1:41280082-41280104 CCCTGCCAATGAGGAGTGTGAGG No data
905851770_905851788 25 Left 905851770 1:41280043-41280065 CCTGCAGATGCCCCTGACCTCCA No data
Right 905851788 1:41280091-41280113 TGAGGAGTGTGAGGCCTGCAGGG No data
905851770_905851781 7 Left 905851770 1:41280043-41280065 CCTGCAGATGCCCCTGACCTCCA No data
Right 905851781 1:41280073-41280095 GGCCATCAGCCCTGCCAATGAGG No data
905851770_905851787 24 Left 905851770 1:41280043-41280065 CCTGCAGATGCCCCTGACCTCCA No data
Right 905851787 1:41280090-41280112 ATGAGGAGTGTGAGGCCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905851770 Original CRISPR TGGAGGTCAGGGGCATCTGC AGG (reversed) Intergenic
No off target data available for this crispr