ID: 905851771

View in Genome Browser
Species Human (GRCh38)
Location 1:41280051-41280073
Sequence TGCCCCTGACCTCCAGCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905851767_905851771 -7 Left 905851767 1:41280035-41280057 CCCCTTCTCCTGCAGATGCCCCT No data
Right 905851771 1:41280051-41280073 TGCCCCTGACCTCCAGCCCCAGG No data
905851766_905851771 -6 Left 905851766 1:41280034-41280056 CCCCCTTCTCCTGCAGATGCCCC No data
Right 905851771 1:41280051-41280073 TGCCCCTGACCTCCAGCCCCAGG No data
905851769_905851771 -9 Left 905851769 1:41280037-41280059 CCTTCTCCTGCAGATGCCCCTGA No data
Right 905851771 1:41280051-41280073 TGCCCCTGACCTCCAGCCCCAGG No data
905851765_905851771 4 Left 905851765 1:41280024-41280046 CCACAGGGAACCCCCTTCTCCTG No data
Right 905851771 1:41280051-41280073 TGCCCCTGACCTCCAGCCCCAGG No data
905851768_905851771 -8 Left 905851768 1:41280036-41280058 CCCTTCTCCTGCAGATGCCCCTG No data
Right 905851771 1:41280051-41280073 TGCCCCTGACCTCCAGCCCCAGG No data
905851762_905851771 22 Left 905851762 1:41280006-41280028 CCTAAGGGAGATGTGGCGCCACA No data
Right 905851771 1:41280051-41280073 TGCCCCTGACCTCCAGCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905851771 Original CRISPR TGCCCCTGACCTCCAGCCCC AGG Intergenic
No off target data available for this crispr