ID: 905851772

View in Genome Browser
Species Human (GRCh38)
Location 1:41280052-41280074
Sequence GCCCCTGACCTCCAGCCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905851766_905851772 -5 Left 905851766 1:41280034-41280056 CCCCCTTCTCCTGCAGATGCCCC No data
Right 905851772 1:41280052-41280074 GCCCCTGACCTCCAGCCCCAGGG No data
905851767_905851772 -6 Left 905851767 1:41280035-41280057 CCCCTTCTCCTGCAGATGCCCCT No data
Right 905851772 1:41280052-41280074 GCCCCTGACCTCCAGCCCCAGGG No data
905851769_905851772 -8 Left 905851769 1:41280037-41280059 CCTTCTCCTGCAGATGCCCCTGA No data
Right 905851772 1:41280052-41280074 GCCCCTGACCTCCAGCCCCAGGG No data
905851765_905851772 5 Left 905851765 1:41280024-41280046 CCACAGGGAACCCCCTTCTCCTG No data
Right 905851772 1:41280052-41280074 GCCCCTGACCTCCAGCCCCAGGG No data
905851768_905851772 -7 Left 905851768 1:41280036-41280058 CCCTTCTCCTGCAGATGCCCCTG No data
Right 905851772 1:41280052-41280074 GCCCCTGACCTCCAGCCCCAGGG No data
905851762_905851772 23 Left 905851762 1:41280006-41280028 CCTAAGGGAGATGTGGCGCCACA No data
Right 905851772 1:41280052-41280074 GCCCCTGACCTCCAGCCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905851772 Original CRISPR GCCCCTGACCTCCAGCCCCA GGG Intergenic
No off target data available for this crispr