ID: 905851773

View in Genome Browser
Species Human (GRCh38)
Location 1:41280053-41280075
Sequence GCCCTGGGGCTGGAGGTCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905851773_905851790 28 Left 905851773 1:41280053-41280075 CCCCTGACCTCCAGCCCCAGGGC No data
Right 905851790 1:41280104-41280126 GCCTGCAGGGTAGAGTCAGAGGG No data
905851773_905851789 27 Left 905851773 1:41280053-41280075 CCCCTGACCTCCAGCCCCAGGGC No data
Right 905851789 1:41280103-41280125 GGCCTGCAGGGTAGAGTCAGAGG No data
905851773_905851787 14 Left 905851773 1:41280053-41280075 CCCCTGACCTCCAGCCCCAGGGC No data
Right 905851787 1:41280090-41280112 ATGAGGAGTGTGAGGCCTGCAGG No data
905851773_905851784 6 Left 905851773 1:41280053-41280075 CCCCTGACCTCCAGCCCCAGGGC No data
Right 905851784 1:41280082-41280104 CCCTGCCAATGAGGAGTGTGAGG No data
905851773_905851781 -3 Left 905851773 1:41280053-41280075 CCCCTGACCTCCAGCCCCAGGGC No data
Right 905851781 1:41280073-41280095 GGCCATCAGCCCTGCCAATGAGG No data
905851773_905851788 15 Left 905851773 1:41280053-41280075 CCCCTGACCTCCAGCCCCAGGGC No data
Right 905851788 1:41280091-41280113 TGAGGAGTGTGAGGCCTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905851773 Original CRISPR GCCCTGGGGCTGGAGGTCAG GGG (reversed) Intergenic