ID: 905851776

View in Genome Browser
Species Human (GRCh38)
Location 1:41280060-41280082
Sequence GCTGATGGCCCTGGGGCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905851776_905851781 -10 Left 905851776 1:41280060-41280082 CCTCCAGCCCCAGGGCCATCAGC No data
Right 905851781 1:41280073-41280095 GGCCATCAGCCCTGCCAATGAGG No data
905851776_905851784 -1 Left 905851776 1:41280060-41280082 CCTCCAGCCCCAGGGCCATCAGC No data
Right 905851784 1:41280082-41280104 CCCTGCCAATGAGGAGTGTGAGG No data
905851776_905851790 21 Left 905851776 1:41280060-41280082 CCTCCAGCCCCAGGGCCATCAGC No data
Right 905851790 1:41280104-41280126 GCCTGCAGGGTAGAGTCAGAGGG No data
905851776_905851789 20 Left 905851776 1:41280060-41280082 CCTCCAGCCCCAGGGCCATCAGC No data
Right 905851789 1:41280103-41280125 GGCCTGCAGGGTAGAGTCAGAGG No data
905851776_905851788 8 Left 905851776 1:41280060-41280082 CCTCCAGCCCCAGGGCCATCAGC No data
Right 905851788 1:41280091-41280113 TGAGGAGTGTGAGGCCTGCAGGG No data
905851776_905851787 7 Left 905851776 1:41280060-41280082 CCTCCAGCCCCAGGGCCATCAGC No data
Right 905851787 1:41280090-41280112 ATGAGGAGTGTGAGGCCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905851776 Original CRISPR GCTGATGGCCCTGGGGCTGG AGG (reversed) Intergenic
No off target data available for this crispr