ID: 905851778

View in Genome Browser
Species Human (GRCh38)
Location 1:41280067-41280089
Sequence TGGCAGGGCTGATGGCCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905851778_905851784 -8 Left 905851778 1:41280067-41280089 CCCCAGGGCCATCAGCCCTGCCA No data
Right 905851784 1:41280082-41280104 CCCTGCCAATGAGGAGTGTGAGG No data
905851778_905851790 14 Left 905851778 1:41280067-41280089 CCCCAGGGCCATCAGCCCTGCCA No data
Right 905851790 1:41280104-41280126 GCCTGCAGGGTAGAGTCAGAGGG No data
905851778_905851789 13 Left 905851778 1:41280067-41280089 CCCCAGGGCCATCAGCCCTGCCA No data
Right 905851789 1:41280103-41280125 GGCCTGCAGGGTAGAGTCAGAGG No data
905851778_905851788 1 Left 905851778 1:41280067-41280089 CCCCAGGGCCATCAGCCCTGCCA No data
Right 905851788 1:41280091-41280113 TGAGGAGTGTGAGGCCTGCAGGG No data
905851778_905851787 0 Left 905851778 1:41280067-41280089 CCCCAGGGCCATCAGCCCTGCCA No data
Right 905851787 1:41280090-41280112 ATGAGGAGTGTGAGGCCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905851778 Original CRISPR TGGCAGGGCTGATGGCCCTG GGG (reversed) Intergenic