ID: 905851779

View in Genome Browser
Species Human (GRCh38)
Location 1:41280068-41280090
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905851779_905851787 -1 Left 905851779 1:41280068-41280090 CCCAGGGCCATCAGCCCTGCCAA No data
Right 905851787 1:41280090-41280112 ATGAGGAGTGTGAGGCCTGCAGG No data
905851779_905851788 0 Left 905851779 1:41280068-41280090 CCCAGGGCCATCAGCCCTGCCAA No data
Right 905851788 1:41280091-41280113 TGAGGAGTGTGAGGCCTGCAGGG No data
905851779_905851789 12 Left 905851779 1:41280068-41280090 CCCAGGGCCATCAGCCCTGCCAA No data
Right 905851789 1:41280103-41280125 GGCCTGCAGGGTAGAGTCAGAGG No data
905851779_905851784 -9 Left 905851779 1:41280068-41280090 CCCAGGGCCATCAGCCCTGCCAA No data
Right 905851784 1:41280082-41280104 CCCTGCCAATGAGGAGTGTGAGG No data
905851779_905851790 13 Left 905851779 1:41280068-41280090 CCCAGGGCCATCAGCCCTGCCAA No data
Right 905851790 1:41280104-41280126 GCCTGCAGGGTAGAGTCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905851779 Original CRISPR TTGGCAGGGCTGATGGCCCT GGG (reversed) Intergenic
No off target data available for this crispr