ID: 905851781

View in Genome Browser
Species Human (GRCh38)
Location 1:41280073-41280095
Sequence GGCCATCAGCCCTGCCAATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905851774_905851781 -4 Left 905851774 1:41280054-41280076 CCCTGACCTCCAGCCCCAGGGCC No data
Right 905851781 1:41280073-41280095 GGCCATCAGCCCTGCCAATGAGG No data
905851765_905851781 26 Left 905851765 1:41280024-41280046 CCACAGGGAACCCCCTTCTCCTG No data
Right 905851781 1:41280073-41280095 GGCCATCAGCCCTGCCAATGAGG No data
905851767_905851781 15 Left 905851767 1:41280035-41280057 CCCCTTCTCCTGCAGATGCCCCT No data
Right 905851781 1:41280073-41280095 GGCCATCAGCCCTGCCAATGAGG No data
905851775_905851781 -5 Left 905851775 1:41280055-41280077 CCTGACCTCCAGCCCCAGGGCCA No data
Right 905851781 1:41280073-41280095 GGCCATCAGCCCTGCCAATGAGG No data
905851770_905851781 7 Left 905851770 1:41280043-41280065 CCTGCAGATGCCCCTGACCTCCA No data
Right 905851781 1:41280073-41280095 GGCCATCAGCCCTGCCAATGAGG No data
905851773_905851781 -3 Left 905851773 1:41280053-41280075 CCCCTGACCTCCAGCCCCAGGGC No data
Right 905851781 1:41280073-41280095 GGCCATCAGCCCTGCCAATGAGG No data
905851769_905851781 13 Left 905851769 1:41280037-41280059 CCTTCTCCTGCAGATGCCCCTGA No data
Right 905851781 1:41280073-41280095 GGCCATCAGCCCTGCCAATGAGG No data
905851766_905851781 16 Left 905851766 1:41280034-41280056 CCCCCTTCTCCTGCAGATGCCCC No data
Right 905851781 1:41280073-41280095 GGCCATCAGCCCTGCCAATGAGG No data
905851776_905851781 -10 Left 905851776 1:41280060-41280082 CCTCCAGCCCCAGGGCCATCAGC No data
Right 905851781 1:41280073-41280095 GGCCATCAGCCCTGCCAATGAGG No data
905851768_905851781 14 Left 905851768 1:41280036-41280058 CCCTTCTCCTGCAGATGCCCCTG No data
Right 905851781 1:41280073-41280095 GGCCATCAGCCCTGCCAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905851781 Original CRISPR GGCCATCAGCCCTGCCAATG AGG Intergenic
No off target data available for this crispr