ID: 905851783

View in Genome Browser
Species Human (GRCh38)
Location 1:41280082-41280104
Sequence CCTCACACTCCTCATTGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905851783_905851790 -1 Left 905851783 1:41280082-41280104 CCCTGCCAATGAGGAGTGTGAGG No data
Right 905851790 1:41280104-41280126 GCCTGCAGGGTAGAGTCAGAGGG No data
905851783_905851792 26 Left 905851783 1:41280082-41280104 CCCTGCCAATGAGGAGTGTGAGG No data
Right 905851792 1:41280131-41280153 AATCATAGACTCCTAGAGTCAGG No data
905851783_905851789 -2 Left 905851783 1:41280082-41280104 CCCTGCCAATGAGGAGTGTGAGG No data
Right 905851789 1:41280103-41280125 GGCCTGCAGGGTAGAGTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905851783 Original CRISPR CCTCACACTCCTCATTGGCA GGG (reversed) Intergenic
No off target data available for this crispr