ID: 905851784

View in Genome Browser
Species Human (GRCh38)
Location 1:41280082-41280104
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905851773_905851784 6 Left 905851773 1:41280053-41280075 CCCCTGACCTCCAGCCCCAGGGC No data
Right 905851784 1:41280082-41280104 CCCTGCCAATGAGGAGTGTGAGG No data
905851770_905851784 16 Left 905851770 1:41280043-41280065 CCTGCAGATGCCCCTGACCTCCA No data
Right 905851784 1:41280082-41280104 CCCTGCCAATGAGGAGTGTGAGG No data
905851774_905851784 5 Left 905851774 1:41280054-41280076 CCCTGACCTCCAGCCCCAGGGCC No data
Right 905851784 1:41280082-41280104 CCCTGCCAATGAGGAGTGTGAGG No data
905851780_905851784 -10 Left 905851780 1:41280069-41280091 CCAGGGCCATCAGCCCTGCCAAT No data
Right 905851784 1:41280082-41280104 CCCTGCCAATGAGGAGTGTGAGG No data
905851778_905851784 -8 Left 905851778 1:41280067-41280089 CCCCAGGGCCATCAGCCCTGCCA No data
Right 905851784 1:41280082-41280104 CCCTGCCAATGAGGAGTGTGAGG No data
905851767_905851784 24 Left 905851767 1:41280035-41280057 CCCCTTCTCCTGCAGATGCCCCT No data
Right 905851784 1:41280082-41280104 CCCTGCCAATGAGGAGTGTGAGG No data
905851766_905851784 25 Left 905851766 1:41280034-41280056 CCCCCTTCTCCTGCAGATGCCCC No data
Right 905851784 1:41280082-41280104 CCCTGCCAATGAGGAGTGTGAGG No data
905851768_905851784 23 Left 905851768 1:41280036-41280058 CCCTTCTCCTGCAGATGCCCCTG No data
Right 905851784 1:41280082-41280104 CCCTGCCAATGAGGAGTGTGAGG No data
905851779_905851784 -9 Left 905851779 1:41280068-41280090 CCCAGGGCCATCAGCCCTGCCAA No data
Right 905851784 1:41280082-41280104 CCCTGCCAATGAGGAGTGTGAGG No data
905851776_905851784 -1 Left 905851776 1:41280060-41280082 CCTCCAGCCCCAGGGCCATCAGC No data
Right 905851784 1:41280082-41280104 CCCTGCCAATGAGGAGTGTGAGG No data
905851769_905851784 22 Left 905851769 1:41280037-41280059 CCTTCTCCTGCAGATGCCCCTGA No data
Right 905851784 1:41280082-41280104 CCCTGCCAATGAGGAGTGTGAGG No data
905851777_905851784 -4 Left 905851777 1:41280063-41280085 CCAGCCCCAGGGCCATCAGCCCT No data
Right 905851784 1:41280082-41280104 CCCTGCCAATGAGGAGTGTGAGG No data
905851775_905851784 4 Left 905851775 1:41280055-41280077 CCTGACCTCCAGCCCCAGGGCCA No data
Right 905851784 1:41280082-41280104 CCCTGCCAATGAGGAGTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type