ID: 905851785

View in Genome Browser
Species Human (GRCh38)
Location 1:41280083-41280105
Sequence GCCTCACACTCCTCATTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905851785_905851790 -2 Left 905851785 1:41280083-41280105 CCTGCCAATGAGGAGTGTGAGGC No data
Right 905851790 1:41280104-41280126 GCCTGCAGGGTAGAGTCAGAGGG No data
905851785_905851792 25 Left 905851785 1:41280083-41280105 CCTGCCAATGAGGAGTGTGAGGC No data
Right 905851792 1:41280131-41280153 AATCATAGACTCCTAGAGTCAGG No data
905851785_905851789 -3 Left 905851785 1:41280083-41280105 CCTGCCAATGAGGAGTGTGAGGC No data
Right 905851789 1:41280103-41280125 GGCCTGCAGGGTAGAGTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905851785 Original CRISPR GCCTCACACTCCTCATTGGC AGG (reversed) Intergenic
No off target data available for this crispr