ID: 905851788

View in Genome Browser
Species Human (GRCh38)
Location 1:41280091-41280113
Sequence TGAGGAGTGTGAGGCCTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905851774_905851788 14 Left 905851774 1:41280054-41280076 CCCTGACCTCCAGCCCCAGGGCC No data
Right 905851788 1:41280091-41280113 TGAGGAGTGTGAGGCCTGCAGGG No data
905851775_905851788 13 Left 905851775 1:41280055-41280077 CCTGACCTCCAGCCCCAGGGCCA No data
Right 905851788 1:41280091-41280113 TGAGGAGTGTGAGGCCTGCAGGG No data
905851773_905851788 15 Left 905851773 1:41280053-41280075 CCCCTGACCTCCAGCCCCAGGGC No data
Right 905851788 1:41280091-41280113 TGAGGAGTGTGAGGCCTGCAGGG No data
905851770_905851788 25 Left 905851770 1:41280043-41280065 CCTGCAGATGCCCCTGACCTCCA No data
Right 905851788 1:41280091-41280113 TGAGGAGTGTGAGGCCTGCAGGG No data
905851776_905851788 8 Left 905851776 1:41280060-41280082 CCTCCAGCCCCAGGGCCATCAGC No data
Right 905851788 1:41280091-41280113 TGAGGAGTGTGAGGCCTGCAGGG No data
905851779_905851788 0 Left 905851779 1:41280068-41280090 CCCAGGGCCATCAGCCCTGCCAA No data
Right 905851788 1:41280091-41280113 TGAGGAGTGTGAGGCCTGCAGGG No data
905851780_905851788 -1 Left 905851780 1:41280069-41280091 CCAGGGCCATCAGCCCTGCCAAT No data
Right 905851788 1:41280091-41280113 TGAGGAGTGTGAGGCCTGCAGGG No data
905851782_905851788 -7 Left 905851782 1:41280075-41280097 CCATCAGCCCTGCCAATGAGGAG No data
Right 905851788 1:41280091-41280113 TGAGGAGTGTGAGGCCTGCAGGG No data
905851778_905851788 1 Left 905851778 1:41280067-41280089 CCCCAGGGCCATCAGCCCTGCCA No data
Right 905851788 1:41280091-41280113 TGAGGAGTGTGAGGCCTGCAGGG No data
905851777_905851788 5 Left 905851777 1:41280063-41280085 CCAGCCCCAGGGCCATCAGCCCT No data
Right 905851788 1:41280091-41280113 TGAGGAGTGTGAGGCCTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905851788 Original CRISPR TGAGGAGTGTGAGGCCTGCA GGG Intergenic
No off target data available for this crispr